\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1004891006:

Variant ID: vg1004891006 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 4891006
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.05, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


ATACAACTGCCCTGAGTTTGTATCTTGTGGCTCTGAGCTGTAGGCGCTTCGCTTCTACTTCATCCTCTAGGAGCCAACCATTCTTGAGGTACTTCACGAA[C/T]
GGTGTTCGCCAGTCTTCTGGGTCTTCGCCCAGTTCTGCCTGGTCAATTGCCATGATGTCCAGGCTCTCTGTGGGCACACTTGGTGCGTACAAGACTTCAA

Reverse complement sequence

TTGAAGTCTTGTACGCACCAAGTGTGCCCACAGAGAGCCTGGACATCATGGCAATTGACCAGGCAGAACTGGGCGAAGACCCAGAAGACTGGCGAACACC[G/A]
TTCGTGAAGTACCTCAAGAATGGTTGGCTCCTAGAGGATGAAGTAGAAGCGAAGCGCCTACAGCTCAGAGCCACAAGATACAAACTCAGGGCAGTTGTAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.30% 39.20% 0.51% 0.00% NA
All Indica  2759 44.10% 55.20% 0.76% 0.00% NA
All Japonica  1512 98.10% 1.80% 0.07% 0.00% NA
Aus  269 3.70% 95.90% 0.37% 0.00% NA
Indica I  595 32.30% 67.10% 0.67% 0.00% NA
Indica II  465 50.10% 49.20% 0.65% 0.00% NA
Indica III  913 53.90% 45.30% 0.77% 0.00% NA
Indica Intermediate  786 38.00% 61.10% 0.89% 0.00% NA
Temperate Japonica  767 99.10% 0.90% 0.00% 0.00% NA
Tropical Japonica  504 97.80% 2.00% 0.20% 0.00% NA
Japonica Intermediate  241 95.90% 4.10% 0.00% 0.00% NA
VI/Aromatic  96 79.20% 20.80% 0.00% 0.00% NA
Intermediate  90 72.20% 26.70% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1004891006 C -> T LOC_Os10g09040.1 synonymous_variant ; p.Pro18Pro; LOW synonymous_codon Average:53.411; most accessible tissue: Zhenshan97 flag leaf, score: 79.481 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1004891006 NA 1.03E-07 mr1222 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004891006 NA 4.24E-10 mr1232 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004891006 NA 8.13E-07 mr1245 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004891006 3.45E-06 NA mr1264 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004891006 NA 6.84E-11 mr1307 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004891006 NA 1.47E-06 mr1420 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004891006 NA 7.03E-06 mr1424 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004891006 NA 1.45E-07 mr1445 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004891006 NA 7.45E-09 mr1575 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004891006 NA 4.81E-06 mr1633 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004891006 NA 6.59E-06 mr1681 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004891006 NA 2.25E-09 mr1730 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004891006 NA 5.33E-07 mr1779 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004891006 NA 1.23E-06 mr1832 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004891006 NA 2.19E-13 mr1853 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004891006 NA 1.05E-09 mr1866 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004891006 NA 4.37E-09 mr1986 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004891006 NA 8.82E-06 mr1164_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004891006 NA 2.10E-06 mr1308_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004891006 NA 7.92E-06 mr1574_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251