\
| Variant ID: vg1004886820 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 4886820 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TTTTACAAGTTGGCGAATGGGGTGCCACCCCTTCTAGACATAGAAACGCTTAAGAGAAGCAGCGTTCCAGGAGTGGTCGAACTCTTCGCCTTCCAGCGTC[G/A]
CCAAGCGAAAAGAGCCCGTCCTGGACCTGTTCTTGATGAGGTATGGCCCTTCCCACTTCGATTCAAGCTTTCCAACCGCCATTGGGTTCGCCTTCTTCCT
AGGAAGAAGGCGAACCCAATGGCGGTTGGAAAGCTTGAATCGAAGTGGGAAGGGCCATACCTCATCAAGAACAGGTCCAGGACGGGCTCTTTTCGCTTGG[C/T]
GACGCTGGAAGGCGAAGAGTTCGACCACTCCTGGAACGCTGCTTCTCTTAAGCGTTTCTATGTCTAGAAGGGGTGGCACCCCATTCGCCAACTTGTAAAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 97.60% | 1.90% | 0.47% | 0.00% | NA |
| All Indica | 2759 | 99.40% | 0.10% | 0.51% | 0.00% | NA |
| All Japonica | 1512 | 93.70% | 5.80% | 0.46% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.50% | 0.00% | 1.51% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.20% | 0.22% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.40% | 0.10% | 0.51% | 0.00% | NA |
| Temperate Japonica | 767 | 95.40% | 4.40% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 90.50% | 8.50% | 0.99% | 0.00% | NA |
| Japonica Intermediate | 241 | 95.00% | 4.60% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 1.10% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1004886820 | G -> A | LOC_Os10g09030.1 | missense_variant ; p.Ala164Val; MODERATE | nonsynonymous_codon ; A164V | Average:43.699; most accessible tissue: Zhenshan97 flag leaf, score: 61.926 | benign |
0.746 |
TOLERATED | 0.19 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1004886820 | NA | 5.12E-06 | mr1232_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004886820 | NA | 6.90E-06 | mr1398_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004886820 | NA | 4.12E-06 | mr1415_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004886820 | 2.28E-06 | 2.28E-06 | mr1424_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004886820 | NA | 3.87E-06 | mr1510_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004886820 | NA | 6.61E-06 | mr1557_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004886820 | NA | 2.34E-07 | mr1558_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004886820 | 7.91E-06 | 7.91E-06 | mr1562_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004886820 | NA | 8.69E-06 | mr1600_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004886820 | NA | 1.67E-07 | mr1676_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004886820 | NA | 8.15E-06 | mr1707_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004886820 | NA | 4.23E-06 | mr1728_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004886820 | NA | 6.66E-06 | mr1884_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |