\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1004886820:

Variant ID: vg1004886820 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 4886820
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTTACAAGTTGGCGAATGGGGTGCCACCCCTTCTAGACATAGAAACGCTTAAGAGAAGCAGCGTTCCAGGAGTGGTCGAACTCTTCGCCTTCCAGCGTC[G/A]
CCAAGCGAAAAGAGCCCGTCCTGGACCTGTTCTTGATGAGGTATGGCCCTTCCCACTTCGATTCAAGCTTTCCAACCGCCATTGGGTTCGCCTTCTTCCT

Reverse complement sequence

AGGAAGAAGGCGAACCCAATGGCGGTTGGAAAGCTTGAATCGAAGTGGGAAGGGCCATACCTCATCAAGAACAGGTCCAGGACGGGCTCTTTTCGCTTGG[C/T]
GACGCTGGAAGGCGAAGAGTTCGACCACTCCTGGAACGCTGCTTCTCTTAAGCGTTTCTATGTCTAGAAGGGGTGGCACCCCATTCGCCAACTTGTAAAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.60% 1.90% 0.47% 0.00% NA
All Indica  2759 99.40% 0.10% 0.51% 0.00% NA
All Japonica  1512 93.70% 5.80% 0.46% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 98.50% 0.00% 1.51% 0.00% NA
Indica II  465 99.60% 0.20% 0.22% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.40% 0.10% 0.51% 0.00% NA
Temperate Japonica  767 95.40% 4.40% 0.13% 0.00% NA
Tropical Japonica  504 90.50% 8.50% 0.99% 0.00% NA
Japonica Intermediate  241 95.00% 4.60% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 97.80% 1.10% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1004886820 G -> A LOC_Os10g09030.1 missense_variant ; p.Ala164Val; MODERATE nonsynonymous_codon ; A164V Average:43.699; most accessible tissue: Zhenshan97 flag leaf, score: 61.926 benign 0.746 TOLERATED 0.19

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1004886820 NA 5.12E-06 mr1232_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004886820 NA 6.90E-06 mr1398_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004886820 NA 4.12E-06 mr1415_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004886820 2.28E-06 2.28E-06 mr1424_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004886820 NA 3.87E-06 mr1510_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004886820 NA 6.61E-06 mr1557_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004886820 NA 2.34E-07 mr1558_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004886820 7.91E-06 7.91E-06 mr1562_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004886820 NA 8.69E-06 mr1600_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004886820 NA 1.67E-07 mr1676_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004886820 NA 8.15E-06 mr1707_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004886820 NA 4.23E-06 mr1728_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004886820 NA 6.66E-06 mr1884_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251