\
| Variant ID: vg1004879281 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 4879281 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 309. )
CTAATCTAATCTAGCAACGCGATTTAGCCGATACCGGCAGAAACCCTAAAGCGAGAGACAGCCGATAGAGCTAAATTGATATGCTAAGACTAGATTAACA[G/T]
AGACATAATAAATAGGTAGGCAAATATATCATCCAAACTAGAGCAATCCAAGAGGTCGAATGTACTGATGCAGCCTTGAACGACGCCGACGTAAACGATA
TATCGTTTACGTCGGCGTCGTTCAAGGCTGCATCAGTACATTCGACCTCTTGGATTGCTCTAGTTTGGATGATATATTTGCCTACCTATTTATTATGTCT[C/A]
TGTTAATCTAGTCTTAGCATATCAATTTAGCTCTATCGGCTGTCTCTCGCTTTAGGGTTTCTGCCGGTATCGGCTAAATCGCGTTGCTAGATTAGATTAG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 76.00% | 23.60% | 0.34% | 0.00% | NA |
| All Indica | 2759 | 65.70% | 33.70% | 0.54% | 0.00% | NA |
| All Japonica | 1512 | 89.60% | 10.40% | 0.00% | 0.00% | NA |
| Aus | 269 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 68.90% | 30.80% | 0.34% | 0.00% | NA |
| Indica II | 465 | 61.90% | 37.40% | 0.65% | 0.00% | NA |
| Indica III | 913 | 62.80% | 36.80% | 0.44% | 0.00% | NA |
| Indica Intermediate | 786 | 69.10% | 30.20% | 0.76% | 0.00% | NA |
| Temperate Japonica | 767 | 94.70% | 5.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 81.70% | 18.30% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 90.00% | 10.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 73.30% | 25.60% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1004879281 | G -> T | LOC_Os10g09020.1 | upstream_gene_variant ; 1821.0bp to feature; MODIFIER | silent_mutation | Average:26.137; most accessible tissue: Minghui63 panicle, score: 50.413 | N | N | N | N |
| vg1004879281 | G -> T | LOC_Os10g09000-LOC_Os10g09020 | intergenic_region ; MODIFIER | silent_mutation | Average:26.137; most accessible tissue: Minghui63 panicle, score: 50.413 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1004879281 | NA | 7.00E-06 | mr1709 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004879281 | NA | 8.43E-07 | mr1053_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004879281 | NA | 2.50E-11 | mr1055_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004879281 | 2.64E-06 | 9.36E-09 | mr1128_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004879281 | NA | 3.13E-06 | mr1147_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004879281 | 1.72E-06 | 1.71E-06 | mr1151_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004879281 | NA | 3.09E-06 | mr1164_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004879281 | 8.17E-06 | 2.79E-07 | mr1204_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004879281 | NA | 6.40E-07 | mr1220_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004879281 | NA | 2.86E-06 | mr1250_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004879281 | 1.03E-06 | 1.03E-06 | mr1250_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004879281 | 2.59E-06 | 2.59E-06 | mr1433_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004879281 | NA | 1.23E-06 | mr1480_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004879281 | NA | 3.69E-07 | mr1558_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004879281 | NA | 4.11E-06 | mr1691_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004879281 | 2.76E-06 | 1.74E-08 | mr1705_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |