Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1004879281:

Variant ID: vg1004879281 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 4879281
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 309. )

Flanking Sequence (100 bp) in Reference Genome:

CTAATCTAATCTAGCAACGCGATTTAGCCGATACCGGCAGAAACCCTAAAGCGAGAGACAGCCGATAGAGCTAAATTGATATGCTAAGACTAGATTAACA[G/T]
AGACATAATAAATAGGTAGGCAAATATATCATCCAAACTAGAGCAATCCAAGAGGTCGAATGTACTGATGCAGCCTTGAACGACGCCGACGTAAACGATA

Reverse complement sequence

TATCGTTTACGTCGGCGTCGTTCAAGGCTGCATCAGTACATTCGACCTCTTGGATTGCTCTAGTTTGGATGATATATTTGCCTACCTATTTATTATGTCT[C/A]
TGTTAATCTAGTCTTAGCATATCAATTTAGCTCTATCGGCTGTCTCTCGCTTTAGGGTTTCTGCCGGTATCGGCTAAATCGCGTTGCTAGATTAGATTAG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	76.00%	23.60%	0.34%	0.00%	NA
All Indica	2759	65.70%	33.70%	0.54%	0.00%	NA
All Japonica	1512	89.60%	10.40%	0.00%	0.00%	NA
Aus	269	98.10%	1.90%	0.00%	0.00%	NA
Indica I	595	68.90%	30.80%	0.34%	0.00%	NA
Indica II	465	61.90%	37.40%	0.65%	0.00%	NA
Indica III	913	62.80%	36.80%	0.44%	0.00%	NA
Indica Intermediate	786	69.10%	30.20%	0.76%	0.00%	NA
Temperate Japonica	767	94.70%	5.30%	0.00%	0.00%	NA
Tropical Japonica	504	81.70%	18.30%	0.00%	0.00%	NA
Japonica Intermediate	241	90.00%	10.00%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	73.30%	25.60%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1004879281	G -> T	LOC_Os10g09020.1	upstream_gene_variant ; 1821.0bp to feature; MODIFIER	silent_mutation	Average:26.137; most accessible tissue: Minghui63 panicle, score: 50.413	N	N	N	N
vg1004879281	G -> T	LOC_Os10g09000-LOC_Os10g09020	intergenic_region ; MODIFIER	silent_mutation	Average:26.137; most accessible tissue: Minghui63 panicle, score: 50.413	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1004879281	NA	7.00E-06	mr1709	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004879281	NA	8.43E-07	mr1053_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004879281	NA	2.50E-11	mr1055_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004879281	2.64E-06	9.36E-09	mr1128_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004879281	NA	3.13E-06	mr1147_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004879281	1.72E-06	1.71E-06	mr1151_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004879281	NA	3.09E-06	mr1164_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004879281	8.17E-06	2.79E-07	mr1204_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004879281	NA	6.40E-07	mr1220_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004879281	NA	2.86E-06	mr1250_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004879281	1.03E-06	1.03E-06	mr1250_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004879281	2.59E-06	2.59E-06	mr1433_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004879281	NA	1.23E-06	mr1480_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004879281	NA	3.69E-07	mr1558_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004879281	NA	4.11E-06	mr1691_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004879281	2.76E-06	1.74E-08	mr1705_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251