\
| Variant ID: vg1004874392 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 4874392 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.90, A: 0.10, others allele: 0.00, population size: 108. )
ATACTAGCTAATACCCTCTATCCGATGCCCTCCTGGTACTTCGAGAAGCCACCCCTGACTGCCGAGTTCCTTACGATAGCCCGTCATGACCATACAACCG[G/A]
GGCTAAATACGGAGGAATACGCTCCTCAGGAAATTAACTTAGGATTATATATAGGCGCGGAGGAATACCCATACTGAGCTGTCACCATCAGCGGCCCACC
GGTGGGCCGCTGATGGTGACAGCTCAGTATGGGTATTCCTCCGCGCCTATATATAATCCTAAGTTAATTTCCTGAGGAGCGTATTCCTCCGTATTTAGCC[C/T]
CGGTTGTATGGTCATGACGGGCTATCGTAAGGAACTCGGCAGTCAGGGGTGGCTTCTCGAAGTACCAGGAGGGCATCGGATAGAGGGTATTAGCTAGTAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 76.10% | 23.90% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 65.80% | 34.10% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 89.60% | 10.40% | 0.00% | 0.00% | NA |
| Aus | 269 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 69.10% | 30.80% | 0.17% | 0.00% | NA |
| Indica II | 465 | 62.40% | 37.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 62.50% | 37.30% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 69.10% | 30.90% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 94.50% | 5.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 81.50% | 18.50% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 90.50% | 9.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 74.40% | 25.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1004874392 | G -> A | LOC_Os10g09000-LOC_Os10g09020 | intergenic_region ; MODIFIER | silent_mutation | Average:41.163; most accessible tissue: Minghui63 young leaf, score: 56.213 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1004874392 | NA | 6.16E-06 | mr1709 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004874392 | NA | 3.52E-06 | mr1053_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004874392 | NA | 3.39E-06 | mr1128_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004874392 | NA | 8.45E-06 | mr1147_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004874392 | 1.08E-06 | 1.08E-06 | mr1151_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004874392 | NA | 9.43E-06 | mr1204_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004874392 | NA | 7.34E-06 | mr1220_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004874392 | NA | 3.46E-06 | mr1250_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004874392 | 2.53E-06 | 2.53E-06 | mr1250_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004874392 | NA | 1.46E-06 | mr1691_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004874392 | 1.43E-06 | 9.50E-08 | mr1705_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004874392 | NA | 8.21E-06 | mr1729_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |