\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1004865986:

Variant ID: vg1004865986 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 4865986
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.01, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


TTTTCGATGTTGTTACTGCGAGAAAGTTATCCTGTTACTGCACGATGACCGTCATGTTACTGCGGAATTCCTGCGAGACGTGAACATCAAAGTGGTTGGC[G/A]
GGGAGGGAGTGAATGTGCGTGTTTGACGTGGGTTTGACCGGCGGGATGGGGTCACACGCGCCACCAATTTCCTGGCGCGCCTCCGCCCGTCCTGTCCTTG

Reverse complement sequence

CAAGGACAGGACGGGCGGAGGCGCGCCAGGAAATTGGTGGCGCGTGTGACCCCATCCCGCCGGTCAAACCCACGTCAAACACGCACATTCACTCCCTCCC[C/T]
GCCAACCACTTTGATGTTCACGTCTCGCAGGAATTCCGCAGTAACATGACGGTCATCGTGCAGTAACAGGATAACTTTCTCGCAGTAACAACATCGAAAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.40% 23.60% 0.25% 0.68% NA
All Indica  2759 65.60% 33.70% 0.36% 0.33% NA
All Japonica  1512 89.50% 10.40% 0.07% 0.07% NA
Aus  269 98.10% 1.90% 0.00% 0.00% NA
Indica I  595 69.10% 30.40% 0.50% 0.00% NA
Indica II  465 61.70% 37.80% 0.22% 0.22% NA
Indica III  913 62.40% 37.00% 0.11% 0.44% NA
Indica Intermediate  786 68.80% 30.00% 0.64% 0.51% NA
Temperate Japonica  767 94.70% 5.20% 0.13% 0.00% NA
Tropical Japonica  504 81.50% 18.50% 0.00% 0.00% NA
Japonica Intermediate  241 89.60% 10.00% 0.00% 0.41% NA
VI/Aromatic  96 80.20% 0.00% 1.04% 18.75% NA
Intermediate  90 68.90% 26.70% 0.00% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1004865986 G -> A LOC_Os10g08990.1 upstream_gene_variant ; 1912.0bp to feature; MODIFIER silent_mutation Average:78.088; most accessible tissue: Minghui63 young leaf, score: 92.394 N N N N
vg1004865986 G -> A LOC_Os10g09000.1 downstream_gene_variant ; 2041.0bp to feature; MODIFIER silent_mutation Average:78.088; most accessible tissue: Minghui63 young leaf, score: 92.394 N N N N
vg1004865986 G -> A LOC_Os10g08990-LOC_Os10g09000 intergenic_region ; MODIFIER silent_mutation Average:78.088; most accessible tissue: Minghui63 young leaf, score: 92.394 N N N N
vg1004865986 G -> DEL N N silent_mutation Average:78.088; most accessible tissue: Minghui63 young leaf, score: 92.394 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1004865986 G A 0.0 0.02 0.03 0.06 0.04 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1004865986 NA 3.83E-07 mr1053 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004865986 NA 7.00E-06 mr1709 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004865986 NA 5.58E-07 mr1053_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004865986 NA 2.50E-11 mr1055_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004865986 NA 4.81E-07 mr1128_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004865986 NA 5.32E-06 mr1147_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004865986 1.90E-06 1.90E-06 mr1151_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004865986 NA 4.77E-06 mr1204_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004865986 NA 1.35E-06 mr1250_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004865986 7.27E-07 7.27E-07 mr1250_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004865986 NA 1.11E-06 mr1480_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004865986 NA 3.69E-07 mr1558_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004865986 NA 3.40E-07 mr1705_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251