Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1004841432:

Variant ID: vg1004841432 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 4841432
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.94, T: 0.07, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:

AATATTGGATACAAAAAATAATTTGGAGCTCCCAGAATATAAACAATAGGACAAAGCGTAGTACTCCCTCTCGTTTCATAATTCTTGACGTTTTGGACAA[T/C]
GACACGGCCTTCAAAATACATCTTTGACTTTGTTTTTCTATTATAATATATATATACAATAAATAAATGCGTGTTTACTTTTTTATGTTGTTCTACTTCC

Reverse complement sequence

GGAAGTAGAACAACATAAAAAAGTAAACACGCATTTATTTATTGTATATATATATTATAATAGAAAAACAAAGTCAAAGATGTATTTTGAAGGCCGTGTC[A/G]
TTGTCCAAAACGTCAAGAATTATGAAACGAGAGGGAGTACTACGCTTTGTCCTATTGTTTATATTCTGGGAGCTCCAAATTATTTTTTGTATCCAATATT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	83.30%	16.70%	0.00%	0.00%	NA
All Indica	2759	91.20%	8.80%	0.00%	0.00%	NA
All Japonica	1512	68.50%	31.50%	0.00%	0.00%	NA
Aus	269	97.80%	2.20%	0.00%	0.00%	NA
Indica I	595	99.70%	0.30%	0.00%	0.00%	NA
Indica II	465	87.50%	12.50%	0.00%	0.00%	NA
Indica III	913	85.10%	14.90%	0.00%	0.00%	NA
Indica Intermediate	786	94.00%	6.00%	0.00%	0.00%	NA
Temperate Japonica	767	70.00%	30.00%	0.00%	0.00%	NA
Tropical Japonica	504	69.40%	30.60%	0.00%	0.00%	NA
Japonica Intermediate	241	61.80%	38.20%	0.00%	0.00%	NA
VI/Aromatic	96	49.00%	51.00%	0.00%	0.00%	NA
Intermediate	90	85.60%	14.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1004841432	T -> C	LOC_Os10g08950.1	upstream_gene_variant ; 1566.0bp to feature; MODIFIER	silent_mutation	Average:41.832; most accessible tissue: Callus, score: 77.417	N	N	N	N
vg1004841432	T -> C	LOC_Os10g08940.1	intron_variant ; MODIFIER	silent_mutation	Average:41.832; most accessible tissue: Callus, score: 77.417	N	N	N	N
vg1004841432	T -> C	LOC_Os10g08940.2	intron_variant ; MODIFIER	silent_mutation	Average:41.832; most accessible tissue: Callus, score: 77.417	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1004841432	NA	3.56E-13	mr1016	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004841432	NA	9.83E-12	mr1017	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004841432	NA	1.29E-09	mr1023	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004841432	NA	9.90E-13	mr1055	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004841432	NA	2.89E-12	mr1079	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004841432	NA	4.33E-11	mr1132	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004841432	NA	3.44E-12	mr1142	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004841432	NA	9.11E-12	mr1178	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004841432	NA	2.02E-13	mr1390	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004841432	NA	2.65E-07	mr1489	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004841432	NA	1.51E-12	mr1490	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004841432	NA	3.40E-11	mr1491	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004841432	NA	3.67E-09	mr1546	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004841432	2.64E-08	9.22E-10	mr1708	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004841432	1.53E-06	7.65E-07	mr1708	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004841432	NA	4.33E-15	mr1022_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004841432	NA	4.57E-12	mr1023_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004841432	NA	2.18E-15	mr1055_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004841432	NA	4.50E-15	mr1079_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004841432	NA	1.14E-12	mr1132_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004841432	NA	2.03E-15	mr1178_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004841432	NA	1.72E-14	mr1390_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004841432	NA	1.05E-13	mr1490_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004841432	6.94E-06	NA	mr1768_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004841432	NA	8.99E-06	mr1768_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251