Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1004789770:

Variant ID: vg1004789770 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 4789770
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.00, others allele: 0.00, population size: 291. )

Flanking Sequence (100 bp) in Reference Genome:

ACAGCTCACATCGCATTGTGACTCGTACAACTTCAAACCATCTTTGTCCCCCTACCTGCGGCGTCACACACTGCACCCACCACTGGCATCGGCCACCTCT[C/T]
CTCGTGTGCTACCTCCCTTCCTCGCCGGTGTGCGAAACTCCACCGTCTCTGATAGCTTGTACCACTAAGATGCCATCATCTTCCGCCTCATAACCAATGT

Reverse complement sequence

ACATTGGTTATGAGGCGGAAGATGATGGCATCTTAGTGGTACAAGCTATCAGAGACGGTGGAGTTTCGCACACCGGCGAGGAAGGGAGGTAGCACACGAG[G/A]
AGAGGTGGCCGATGCCAGTGGTGGGTGCAGTGTGTGACGCCGCAGGTAGGGGGACAAAGATGGTTTGAAGTTGTACGAGTCACAATGCGATGTGAGCTGT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	97.00%	2.90%	0.08%	0.00%	NA
All Indica	2759	99.80%	0.20%	0.00%	0.00%	NA
All Japonica	1512	92.30%	7.40%	0.26%	0.00%	NA
Aus	269	98.90%	1.10%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	99.70%	0.30%	0.00%	0.00%	NA
Indica Intermediate	786	99.70%	0.30%	0.00%	0.00%	NA
Temperate Japonica	767	88.00%	11.50%	0.52%	0.00%	NA
Tropical Japonica	504	99.20%	0.80%	0.00%	0.00%	NA
Japonica Intermediate	241	91.70%	8.30%	0.00%	0.00%	NA
VI/Aromatic	96	82.30%	17.70%	0.00%	0.00%	NA
Intermediate	90	97.80%	2.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1004789770	C -> T	LOC_Os10g08840.1	downstream_gene_variant ; 1050.0bp to feature; MODIFIER	silent_mutation	Average:89.939; most accessible tissue: Callus, score: 94.336	N	N	N	N
vg1004789770	C -> T	LOC_Os10g08850.1	downstream_gene_variant ; 976.0bp to feature; MODIFIER	silent_mutation	Average:89.939; most accessible tissue: Callus, score: 94.336	N	N	N	N
vg1004789770	C -> T	LOC_Os10g08840.2	downstream_gene_variant ; 1048.0bp to feature; MODIFIER	silent_mutation	Average:89.939; most accessible tissue: Callus, score: 94.336	N	N	N	N
vg1004789770	C -> T	LOC_Os10g08840-LOC_Os10g08850	intergenic_region ; MODIFIER	silent_mutation	Average:89.939; most accessible tissue: Callus, score: 94.336	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg1004789770	C	T	-0.02	-0.02	-0.02	-0.02	-0.02	-0.01

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1004789770	1.49E-09	3.60E-13	mr1210	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004789770	4.98E-08	4.93E-12	mr1305	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004789770	9.73E-06	9.73E-06	mr1409	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004789770	3.93E-11	5.18E-16	mr1585	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004789770	1.30E-08	3.68E-12	mr1586	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004789770	NA	3.23E-07	mr1765	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004789770	3.43E-06	3.43E-06	mr1166_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004789770	2.92E-11	4.89E-14	mr1305_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004789770	2.93E-06	2.46E-07	mr1409_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004789770	NA	5.26E-06	mr1559_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004789770	1.90E-12	1.92E-18	mr1585_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004789770	NA	9.45E-06	mr1765_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251