Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1004782103:

Variant ID: vg1004782103 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 4782103
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, A: 0.06, others allele: 0.00, population size: 204. )

Flanking Sequence (100 bp) in Reference Genome:


CTCTATAACAAAGCAAATACAAAAGGCAGGTTTTTTTTTATCTCATGGCCGCACGGAATCGTGGAGATGTCCATTAAACTCATAAATTATTAAGTGTATT[G/A]
GTTATTTGGCTACAAAAGTGTGTCACTACAAATTAGTCGCCGGCTCTCTTTTTACATAATTGATAGAAATTCGATCTTTATATTTATAAGTGGATATATA

Reverse complement sequence

TATATATCCACTTATAAATATAAAGATCGAATTTCTATCAATTATGTAAAAAGAGAGCCGGCGACTAATTTGTAGTGACACACTTTTGTAGCCAAATAAC[C/T]
AATACACTTAATAATTTATGAGTTTAATGGACATCTCCACGATTCCGTGCGGCCATGAGATAAAAAAAAACCTGCCTTTTGTATTTGCTTTGTTATAGAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.60% 13.40% 0.02% 0.00% NA
All Indica  2759 89.80% 10.20% 0.00% 0.00% NA
All Japonica  1512 80.60% 19.40% 0.00% 0.00% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 99.70% 0.30% 0.00% 0.00% NA
Indica II  465 87.10% 12.90% 0.00% 0.00% NA
Indica III  913 82.10% 17.90% 0.00% 0.00% NA
Indica Intermediate  786 92.90% 7.10% 0.00% 0.00% NA
Temperate Japonica  767 79.80% 20.20% 0.00% 0.00% NA
Tropical Japonica  504 86.70% 13.30% 0.00% 0.00% NA
Japonica Intermediate  241 70.10% 29.90% 0.00% 0.00% NA
VI/Aromatic  96 53.10% 46.90% 0.00% 0.00% NA
Intermediate  90 88.90% 10.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1004782103 G -> A LOC_Os10g08830.1 upstream_gene_variant ; 1115.0bp to feature; MODIFIER silent_mutation Average:73.018; most accessible tissue: Zhenshan97 flower, score: 89.772 N N N N
vg1004782103 G -> A LOC_Os10g08840.1 upstream_gene_variant ; 1140.0bp to feature; MODIFIER silent_mutation Average:73.018; most accessible tissue: Zhenshan97 flower, score: 89.772 N N N N
vg1004782103 G -> A LOC_Os10g08840.2 upstream_gene_variant ; 1140.0bp to feature; MODIFIER silent_mutation Average:73.018; most accessible tissue: Zhenshan97 flower, score: 89.772 N N N N
vg1004782103 G -> A LOC_Os10g08830-LOC_Os10g08840 intergenic_region ; MODIFIER silent_mutation Average:73.018; most accessible tissue: Zhenshan97 flower, score: 89.772 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1004782103 G A 0.01 0.01 0.01 0.01 0.02 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1004782103 NA 8.56E-07 mr1368 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004782103 NA 1.57E-07 mr1489 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004782103 1.90E-06 NA mr1853 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004782103 NA 3.80E-06 mr1113_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004782103 NA 1.40E-06 mr1120_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004782103 NA 3.10E-06 mr1247_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251