RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg1004777607:

Variant ID: vg1004777607 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 4777607
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:

ATCATAAAAGTAATTTGTGATTTTTCATCAAAATATAATCATGTGAGATCTTGTTGTAAAGATTTAATTGTTACGAACACAATGGTATAATCGGATCGTA[G/A]
ATCAGATGAGTAGTTTAAGAGAAAATTTCATAAGAAGAAAAAAAATATGCACAACCTAATAGCAAAAACTACTTGCATGCATGTCTGTCACGCTACTAGT

Reverse complement sequence

ACTAGTAGCGTGACAGACATGCATGCAAGTAGTTTTTGCTATTAGGTTGTGCATATTTTTTTTCTTCTTATGAAATTTTCTCTTAAACTACTCATCTGAT[C/T]
TACGATCCGATTATACCATTGTGTTCGTAACAATTAAATCTTTACAACAAGATCTCACATGATTATATTTTGATGAAAAATCACAAATTACTTTTATGAT

Allele Frequencies:

Search:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	96.90%	1.10%	1.95%	0.00%	NA
All Indica	2759	100.00%	0.00%	0.04%	0.00%	NA
All Japonica	1512	90.60%	3.50%	5.89%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.80%	0.00%	0.17%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	100.00%	0.00%	0.00%	0.00%	NA
Temperate Japonica	767	82.30%	6.90%	10.82%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	97.50%	0.00%	2.49%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	97.80%	0.00%	2.22%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1004777607	G -> A	LOC_Os10g08820.1	downstream_gene_variant ; 4761.0bp to feature; MODIFIER	silent_mutation	Average:23.955; most accessible tissue: Zhenshan97 panicle, score: 43.098	N	N	N	N
vg1004777607	G -> A	LOC_Os10g08830.1	intron_variant ; MODIFIER	silent_mutation	Average:23.955; most accessible tissue: Zhenshan97 panicle, score: 43.098	N	N	N	N

Showing 1 to 2 of 2 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1004777607	4.90E-06	NA	mr1310	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004777607	NA	5.42E-07	mr1354	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004777607	3.53E-07	NA	mr1926	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004777607	NA	5.81E-07	mr1354_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004777607	NA	3.57E-06	mr1902_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 5 of 5 entries

Previous1Next

Search for Variation information by Variation ID:

Detailed information for vg1004777607:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact