\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1004777607:

Variant ID: vg1004777607 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 4777607
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:


ATCATAAAAGTAATTTGTGATTTTTCATCAAAATATAATCATGTGAGATCTTGTTGTAAAGATTTAATTGTTACGAACACAATGGTATAATCGGATCGTA[G/A]
ATCAGATGAGTAGTTTAAGAGAAAATTTCATAAGAAGAAAAAAAATATGCACAACCTAATAGCAAAAACTACTTGCATGCATGTCTGTCACGCTACTAGT

Reverse complement sequence

ACTAGTAGCGTGACAGACATGCATGCAAGTAGTTTTTGCTATTAGGTTGTGCATATTTTTTTTCTTCTTATGAAATTTTCTCTTAAACTACTCATCTGAT[C/T]
TACGATCCGATTATACCATTGTGTTCGTAACAATTAAATCTTTACAACAAGATCTCACATGATTATATTTTGATGAAAAATCACAAATTACTTTTATGAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 96.90% 1.10% 1.95% 0.00% NA
All Indica  2759 100.00% 0.00% 0.04% 0.00% NA
All Japonica  1512 90.60% 3.50% 5.89% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.00% 0.17% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 100.00% 0.00% 0.00% 0.00% NA
Temperate Japonica  767 82.30% 6.90% 10.82% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 97.50% 0.00% 2.49% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 97.80% 0.00% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1004777607 G -> A LOC_Os10g08820.1 downstream_gene_variant ; 4761.0bp to feature; MODIFIER silent_mutation Average:23.955; most accessible tissue: Zhenshan97 panicle, score: 43.098 N N N N
vg1004777607 G -> A LOC_Os10g08830.1 intron_variant ; MODIFIER silent_mutation Average:23.955; most accessible tissue: Zhenshan97 panicle, score: 43.098 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1004777607 4.90E-06 NA mr1310 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004777607 NA 5.42E-07 mr1354 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004777607 3.53E-07 NA mr1926 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004777607 NA 5.81E-07 mr1354_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004777607 NA 3.57E-06 mr1902_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251