RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg1004766552:

Variant ID: vg1004766552 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 4766552
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 93. )

Flanking Sequence (100 bp) in Reference Genome:

CTGCATTTATGTAAGACTTTTATGATGTTTGTAAGACGTGGATCTGGATGTCAACATTGTCGTTTGTGTACCCCGGCCGGTCCTGGACGGGGATTTTAAT[A/G]
CACATTCTGCTTGAAATTCTATTCGGGAATTTCTGGGCGTGACAAGTTGGTATCAGAGCCGACCTTGACCGTAGGACAAGCCAAACGGAAAAAAAAACCT

Reverse complement sequence

AGGTTTTTTTTTCCGTTTGGCTTGTCCTACGGTCAAGGTCGGCTCTGATACCAACTTGTCACGCCCAGAAATTCCCGAATAGAATTTCAAGCAGAATGTG[T/C]
ATTAAAATCCCCGTCCAGGACCGGCCGGGGTACACAAACGACAATGTTGACATCCAGATCCACGTCTTACAAACATCATAAAAGTCTTACATAAATGCAG

Allele Frequencies:

Search:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	65.20%	0.80%	18.98%	14.98%	NA
All Indica	2759	54.20%	1.30%	30.08%	14.46%	NA
All Japonica	1512	78.00%	0.10%	2.58%	19.31%	NA
Aus	269	93.30%	0.40%	5.20%	1.12%	NA
Indica I	595	68.10%	0.00%	15.97%	15.97%	NA
Indica II	465	43.20%	1.50%	34.41%	20.86%	NA
Indica III	913	51.60%	2.40%	37.46%	8.54%	NA
Indica Intermediate	786	53.10%	0.90%	29.64%	16.41%	NA
Temperate Japonica	767	74.40%	0.00%	2.35%	23.21%	NA
Tropical Japonica	504	83.90%	0.00%	2.18%	13.89%	NA
Japonica Intermediate	241	77.20%	0.40%	4.15%	18.26%	NA
VI/Aromatic	96	93.80%	0.00%	4.17%	2.08%	NA
Intermediate	90	74.40%	1.10%	11.11%	13.33%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1004766552	A -> G	LOC_Os10g08800.1	upstream_gene_variant ; 1616.0bp to feature; MODIFIER	silent_mutation	Average:32.326; most accessible tissue: Zhenshan97 flag leaf, score: 65.82	N	N	N	N
vg1004766552	A -> G	LOC_Os10g08810.1	upstream_gene_variant ; 541.0bp to feature; MODIFIER	silent_mutation	Average:32.326; most accessible tissue: Zhenshan97 flag leaf, score: 65.82	N	N	N	N
vg1004766552	A -> G	LOC_Os10g08820.1	upstream_gene_variant ; 1729.0bp to feature; MODIFIER	silent_mutation	Average:32.326; most accessible tissue: Zhenshan97 flag leaf, score: 65.82	N	N	N	N
vg1004766552	A -> G	LOC_Os10g08790.1	downstream_gene_variant ; 3219.0bp to feature; MODIFIER	silent_mutation	Average:32.326; most accessible tissue: Zhenshan97 flag leaf, score: 65.82	N	N	N	N
vg1004766552	A -> G	LOC_Os10g08800-LOC_Os10g08810	intergenic_region ; MODIFIER	silent_mutation	Average:32.326; most accessible tissue: Zhenshan97 flag leaf, score: 65.82	N	N	N	N
vg1004766552	A -> DEL	N	N	silent_mutation	Average:32.326; most accessible tissue: Zhenshan97 flag leaf, score: 65.82	N	N	N	N

Showing 1 to 6 of 6 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1004766552	NA	6.31E-06	mr1300	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004766552	3.38E-06	NA	mr1926	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 2 of 2 entries

Previous1Next

Search for Variation information by Variation ID:

Detailed information for vg1004766552:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact