\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1004766552:

Variant ID: vg1004766552 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 4766552
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 93. )

Flanking Sequence (100 bp) in Reference Genome:


CTGCATTTATGTAAGACTTTTATGATGTTTGTAAGACGTGGATCTGGATGTCAACATTGTCGTTTGTGTACCCCGGCCGGTCCTGGACGGGGATTTTAAT[A/G]
CACATTCTGCTTGAAATTCTATTCGGGAATTTCTGGGCGTGACAAGTTGGTATCAGAGCCGACCTTGACCGTAGGACAAGCCAAACGGAAAAAAAAACCT

Reverse complement sequence

AGGTTTTTTTTTCCGTTTGGCTTGTCCTACGGTCAAGGTCGGCTCTGATACCAACTTGTCACGCCCAGAAATTCCCGAATAGAATTTCAAGCAGAATGTG[T/C]
ATTAAAATCCCCGTCCAGGACCGGCCGGGGTACACAAACGACAATGTTGACATCCAGATCCACGTCTTACAAACATCATAAAAGTCTTACATAAATGCAG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.20% 0.80% 18.98% 14.98% NA
All Indica  2759 54.20% 1.30% 30.08% 14.46% NA
All Japonica  1512 78.00% 0.10% 2.58% 19.31% NA
Aus  269 93.30% 0.40% 5.20% 1.12% NA
Indica I  595 68.10% 0.00% 15.97% 15.97% NA
Indica II  465 43.20% 1.50% 34.41% 20.86% NA
Indica III  913 51.60% 2.40% 37.46% 8.54% NA
Indica Intermediate  786 53.10% 0.90% 29.64% 16.41% NA
Temperate Japonica  767 74.40% 0.00% 2.35% 23.21% NA
Tropical Japonica  504 83.90% 0.00% 2.18% 13.89% NA
Japonica Intermediate  241 77.20% 0.40% 4.15% 18.26% NA
VI/Aromatic  96 93.80% 0.00% 4.17% 2.08% NA
Intermediate  90 74.40% 1.10% 11.11% 13.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1004766552 A -> G LOC_Os10g08800.1 upstream_gene_variant ; 1616.0bp to feature; MODIFIER silent_mutation Average:32.326; most accessible tissue: Zhenshan97 flag leaf, score: 65.82 N N N N
vg1004766552 A -> G LOC_Os10g08810.1 upstream_gene_variant ; 541.0bp to feature; MODIFIER silent_mutation Average:32.326; most accessible tissue: Zhenshan97 flag leaf, score: 65.82 N N N N
vg1004766552 A -> G LOC_Os10g08820.1 upstream_gene_variant ; 1729.0bp to feature; MODIFIER silent_mutation Average:32.326; most accessible tissue: Zhenshan97 flag leaf, score: 65.82 N N N N
vg1004766552 A -> G LOC_Os10g08790.1 downstream_gene_variant ; 3219.0bp to feature; MODIFIER silent_mutation Average:32.326; most accessible tissue: Zhenshan97 flag leaf, score: 65.82 N N N N
vg1004766552 A -> G LOC_Os10g08800-LOC_Os10g08810 intergenic_region ; MODIFIER silent_mutation Average:32.326; most accessible tissue: Zhenshan97 flag leaf, score: 65.82 N N N N
vg1004766552 A -> DEL N N silent_mutation Average:32.326; most accessible tissue: Zhenshan97 flag leaf, score: 65.82 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1004766552 NA 6.31E-06 mr1300 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004766552 3.38E-06 NA mr1926 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251