\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1004756810:

Variant ID: vg1004756810 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 4756810
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, T: 0.00, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:


GTGCTGGACTGCTGGCTGGGTACAATGCATCCACGCAAAACTCTCCTATTTTGCATCCACGAAAAACTCTCCTATAAAGTTAGAAAATTTTGATAACATA[G/T]
ATTAATACGTGATATGATATGTCACCCTCATAAATATGAGCAAGTTCACATTTATTAACTTCTACGTGTTGAAAAAAAAAAACAGGGCGAGTGCACGTAT

Reverse complement sequence

ATACGTGCACTCGCCCTGTTTTTTTTTTTCAACACGTAGAAGTTAATAAATGTGAACTTGCTCATATTTATGAGGGTGACATATCATATCACGTATTAAT[C/A]
TATGTTATCAAAATTTTCTAACTTTATAGGAGAGTTTTTCGTGGATGCAAAATAGGAGAGTTTTGCGTGGATGCATTGTACCCAGCCAGCAGTCCAGCAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.50% 36.00% 0.44% 0.00% NA
All Indica  2759 60.00% 39.40% 0.58% 0.00% NA
All Japonica  1512 64.20% 35.60% 0.20% 0.00% NA
Aus  269 95.90% 4.10% 0.00% 0.00% NA
Indica I  595 60.00% 39.50% 0.50% 0.00% NA
Indica II  465 54.80% 44.70% 0.43% 0.00% NA
Indica III  913 60.10% 39.30% 0.55% 0.00% NA
Indica Intermediate  786 62.80% 36.40% 0.76% 0.00% NA
Temperate Japonica  767 90.40% 9.50% 0.13% 0.00% NA
Tropical Japonica  504 19.00% 80.60% 0.40% 0.00% NA
Japonica Intermediate  241 75.10% 24.90% 0.00% 0.00% NA
VI/Aromatic  96 75.00% 25.00% 0.00% 0.00% NA
Intermediate  90 53.30% 44.40% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1004756810 G -> T LOC_Os10g08780.1 upstream_gene_variant ; 703.0bp to feature; MODIFIER silent_mutation Average:72.403; most accessible tissue: Callus, score: 93.922 N N N N
vg1004756810 G -> T LOC_Os10g08760-LOC_Os10g08780 intergenic_region ; MODIFIER silent_mutation Average:72.403; most accessible tissue: Callus, score: 93.922 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1004756810 G T 0.0 0.01 -0.01 0.01 0.03 0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1004756810 NA 1.26E-12 Grain_thickness Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1004756810 NA 5.19E-07 mr1551 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004756810 NA 7.20E-07 mr1584 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004756810 NA 3.54E-08 mr1603 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004756810 NA 6.05E-07 mr1942 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004756810 NA 1.44E-06 mr1121_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004756810 NA 8.70E-08 mr1125_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004756810 NA 2.29E-06 mr1206_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004756810 NA 2.01E-06 mr1248_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004756810 2.64E-06 3.86E-10 mr1250_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004756810 NA 1.29E-07 mr1250_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004756810 NA 3.32E-06 mr1308_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004756810 NA 2.08E-07 mr1603_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004756810 NA 3.24E-06 mr1691_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004756810 NA 7.67E-11 mr1771_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004756810 NA 2.13E-06 mr1780_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004756810 NA 3.17E-11 mr1784_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004756810 NA 1.38E-08 mr1800_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004756810 NA 1.06E-11 mr1862_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251