\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1004753931:

Variant ID: vg1004753931 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 4753931
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, T: 0.04, others allele: 0.00, population size: 112. )

Flanking Sequence (100 bp) in Reference Genome:


CAAGTGGAAATAGATTATTCTAAAACAAATATGTATTGCAAGCATAGCTAGCTCTCCTTTATTTTAGTAATATTGACTGTCGAAATTGGTCTATAACGAC[C/T]
GTCAATAGCCGCCACCGCCCCCTCCCGTACGTCGCTTGCTCCCAGCCGTGCTCGTCCTTGTCGGCAGCGGTGCCAAGCTGCCGCCGTCCGCCGCCCGCCA

Reverse complement sequence

TGGCGGGCGGCGGACGGCGGCAGCTTGGCACCGCTGCCGACAAGGACGAGCACGGCTGGGAGCAAGCGACGTACGGGAGGGGGCGGTGGCGGCTATTGAC[G/A]
GTCGTTATAGACCAATTTCGACAGTCAATATTACTAAAATAAAGGAGAGCTAGCTATGCTTGCAATACATATTTGTTTTAGAATAATCTATTTCCACTTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.40% 26.00% 1.76% 1.84% NA
All Indica  2759 60.50% 35.20% 2.83% 1.49% NA
All Japonica  1512 82.80% 15.10% 0.20% 1.92% NA
Aus  269 97.40% 1.90% 0.00% 0.74% NA
Indica I  595 59.80% 37.00% 2.35% 0.84% NA
Indica II  465 54.80% 41.90% 2.80% 0.43% NA
Indica III  913 60.50% 33.30% 3.72% 2.52% NA
Indica Intermediate  786 64.40% 32.10% 2.16% 1.40% NA
Temperate Japonica  767 81.20% 14.90% 0.13% 3.78% NA
Tropical Japonica  504 81.50% 18.30% 0.20% 0.00% NA
Japonica Intermediate  241 90.50% 9.10% 0.41% 0.00% NA
VI/Aromatic  96 85.40% 0.00% 0.00% 14.58% NA
Intermediate  90 71.10% 25.60% 2.22% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1004753931 C -> T LOC_Os10g08780.1 upstream_gene_variant ; 3582.0bp to feature; MODIFIER silent_mutation Average:62.39; most accessible tissue: Callus, score: 79.659 N N N N
vg1004753931 C -> T LOC_Os10g08760-LOC_Os10g08780 intergenic_region ; MODIFIER silent_mutation Average:62.39; most accessible tissue: Callus, score: 79.659 N N N N
vg1004753931 C -> DEL N N silent_mutation Average:62.39; most accessible tissue: Callus, score: 79.659 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1004753931 NA 1.42E-06 mr1379_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004753931 NA 8.05E-07 mr1409_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004753931 NA 2.12E-06 mr1415_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004753931 NA 9.87E-07 mr1558_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004753931 NA 3.46E-09 mr1559_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004753931 3.59E-06 3.59E-06 mr1649_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004753931 NA 2.65E-06 mr1691_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251