\
| Variant ID: vg1004753931 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 4753931 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, T: 0.04, others allele: 0.00, population size: 112. )
CAAGTGGAAATAGATTATTCTAAAACAAATATGTATTGCAAGCATAGCTAGCTCTCCTTTATTTTAGTAATATTGACTGTCGAAATTGGTCTATAACGAC[C/T]
GTCAATAGCCGCCACCGCCCCCTCCCGTACGTCGCTTGCTCCCAGCCGTGCTCGTCCTTGTCGGCAGCGGTGCCAAGCTGCCGCCGTCCGCCGCCCGCCA
TGGCGGGCGGCGGACGGCGGCAGCTTGGCACCGCTGCCGACAAGGACGAGCACGGCTGGGAGCAAGCGACGTACGGGAGGGGGCGGTGGCGGCTATTGAC[G/A]
GTCGTTATAGACCAATTTCGACAGTCAATATTACTAAAATAAAGGAGAGCTAGCTATGCTTGCAATACATATTTGTTTTAGAATAATCTATTTCCACTTG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 70.40% | 26.00% | 1.76% | 1.84% | NA |
| All Indica | 2759 | 60.50% | 35.20% | 2.83% | 1.49% | NA |
| All Japonica | 1512 | 82.80% | 15.10% | 0.20% | 1.92% | NA |
| Aus | 269 | 97.40% | 1.90% | 0.00% | 0.74% | NA |
| Indica I | 595 | 59.80% | 37.00% | 2.35% | 0.84% | NA |
| Indica II | 465 | 54.80% | 41.90% | 2.80% | 0.43% | NA |
| Indica III | 913 | 60.50% | 33.30% | 3.72% | 2.52% | NA |
| Indica Intermediate | 786 | 64.40% | 32.10% | 2.16% | 1.40% | NA |
| Temperate Japonica | 767 | 81.20% | 14.90% | 0.13% | 3.78% | NA |
| Tropical Japonica | 504 | 81.50% | 18.30% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 90.50% | 9.10% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 85.40% | 0.00% | 0.00% | 14.58% | NA |
| Intermediate | 90 | 71.10% | 25.60% | 2.22% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1004753931 | C -> T | LOC_Os10g08780.1 | upstream_gene_variant ; 3582.0bp to feature; MODIFIER | silent_mutation | Average:62.39; most accessible tissue: Callus, score: 79.659 | N | N | N | N |
| vg1004753931 | C -> T | LOC_Os10g08760-LOC_Os10g08780 | intergenic_region ; MODIFIER | silent_mutation | Average:62.39; most accessible tissue: Callus, score: 79.659 | N | N | N | N |
| vg1004753931 | C -> DEL | N | N | silent_mutation | Average:62.39; most accessible tissue: Callus, score: 79.659 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1004753931 | NA | 1.42E-06 | mr1379_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004753931 | NA | 8.05E-07 | mr1409_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004753931 | NA | 2.12E-06 | mr1415_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004753931 | NA | 9.87E-07 | mr1558_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004753931 | NA | 3.46E-09 | mr1559_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004753931 | 3.59E-06 | 3.59E-06 | mr1649_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004753931 | NA | 2.65E-06 | mr1691_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |