\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1004752391:

Variant ID: vg1004752391 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 4752391
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 295. )

Flanking Sequence (100 bp) in Reference Genome:


GGGATGGATTCGGACTGCAGCACAACACCAACTTCTGACGGCCGCCACAACTTCATGCGAACTCCGATTTGGGTGTGCAAGTACTTCATGGAAATCTTGT[C/A]
AAGTATACTTTCAAATGGATCCAGCCTCATGTCCATATCAGTTCTGGAGCGGCCGCAATCTTCGTTTTACTACCGAGTCCTTTTCTGTCCACAGTGCTGC

Reverse complement sequence

GCAGCACTGTGGACAGAAAAGGACTCGGTAGTAAAACGAAGATTGCGGCCGCTCCAGAACTGATATGGACATGAGGCTGGATCCATTTGAAAGTATACTT[G/T]
ACAAGATTTCCATGAAGTACTTGCACACCCAAATCGGAGTTCGCATGAAGTTGTGGCGGCCGTCAGAAGTTGGTGTTGTGCTGCAGTCCGAATCCATCCC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.40% 7.20% 1.12% 3.30% NA
All Indica  2759 95.70% 0.90% 1.56% 1.92% NA
All Japonica  1512 75.30% 18.50% 0.46% 5.82% NA
Aus  269 99.30% 0.00% 0.00% 0.74% NA
Indica I  595 99.70% 0.00% 0.00% 0.34% NA
Indica II  465 99.40% 0.00% 0.22% 0.43% NA
Indica III  913 90.70% 1.20% 3.18% 4.93% NA
Indica Intermediate  786 96.20% 1.70% 1.65% 0.51% NA
Temperate Japonica  767 91.70% 3.70% 0.39% 4.30% NA
Tropical Japonica  504 55.80% 42.90% 0.40% 0.99% NA
Japonica Intermediate  241 63.90% 14.50% 0.83% 20.75% NA
VI/Aromatic  96 61.50% 24.00% 2.08% 12.50% NA
Intermediate  90 84.40% 13.30% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1004752391 C -> A LOC_Os10g08760.1 upstream_gene_variant ; 3838.0bp to feature; MODIFIER silent_mutation Average:48.828; most accessible tissue: Zhenshan97 panicle, score: 59.59 N N N N
vg1004752391 C -> A LOC_Os10g08754.1 downstream_gene_variant ; 4951.0bp to feature; MODIFIER silent_mutation Average:48.828; most accessible tissue: Zhenshan97 panicle, score: 59.59 N N N N
vg1004752391 C -> A LOC_Os10g08760-LOC_Os10g08780 intergenic_region ; MODIFIER silent_mutation Average:48.828; most accessible tissue: Zhenshan97 panicle, score: 59.59 N N N N
vg1004752391 C -> DEL N N silent_mutation Average:48.828; most accessible tissue: Zhenshan97 panicle, score: 59.59 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1004752391 NA 2.68E-08 mr1570 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004752391 NA 5.74E-06 mr1068_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004752391 NA 4.57E-06 mr1072_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004752391 NA 3.03E-09 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004752391 NA 6.44E-06 mr1091_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004752391 NA 4.32E-06 mr1109_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004752391 NA 5.40E-06 mr1110_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004752391 NA 6.06E-07 mr1112_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004752391 NA 9.40E-07 mr1121_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004752391 NA 7.70E-09 mr1136_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004752391 NA 1.60E-06 mr1149_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004752391 NA 9.81E-06 mr1200_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004752391 6.54E-06 6.54E-06 mr1234_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004752391 NA 2.68E-06 mr1243_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004752391 NA 6.43E-07 mr1248_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004752391 NA 5.07E-08 mr1250_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004752391 NA 6.67E-07 mr1257_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004752391 NA 3.42E-07 mr1423_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004752391 NA 7.73E-07 mr1441_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004752391 4.72E-06 4.72E-06 mr1541_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004752391 NA 8.83E-06 mr1865_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251