\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1004750280:

Variant ID: vg1004750280 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 4750280
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 295. )

Flanking Sequence (100 bp) in Reference Genome:


TTGATACTAGTGATTATCTCGTGGTTATGACTTCTAGATAATTTATATACGTGTGTAACATTGTTTTGTGATAATGTTGAGTCACGCTATGAAAAAATTT[G/T]
TGCTCGGATATTGTTTCTTGTTTGATTCATATGTAGGTGTGTCTTGATGCTTCAGAAGAGTATTGCCAGTGATGGATTAGGAGTCAACTTGAGAGAATAT

Reverse complement sequence

ATATTCTCTCAAGTTGACTCCTAATCCATCACTGGCAATACTCTTCTGAAGCATCAAGACACACCTACATATGAATCAAACAAGAAACAATATCCGAGCA[C/A]
AAATTTTTTCATAGCGTGACTCAACATTATCACAAAACAATGTTACACACGTATATAAATTATCTAGAAGTCATAACCACGAGATAATCACTAGTATCAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.40% 14.60% 0.36% 4.55% NA
All Indica  2759 88.90% 6.80% 0.51% 3.73% NA
All Japonica  1512 63.80% 29.80% 0.13% 6.22% NA
Aus  269 99.30% 0.00% 0.00% 0.74% NA
Indica I  595 99.70% 0.00% 0.00% 0.34% NA
Indica II  465 87.10% 12.00% 0.00% 0.86% NA
Indica III  913 80.50% 10.20% 0.99% 8.32% NA
Indica Intermediate  786 91.70% 5.00% 0.64% 2.67% NA
Temperate Japonica  767 86.00% 9.10% 0.26% 4.56% NA
Tropical Japonica  504 43.50% 55.20% 0.00% 1.39% NA
Japonica Intermediate  241 35.70% 42.70% 0.00% 21.58% NA
VI/Aromatic  96 49.00% 37.50% 0.00% 13.54% NA
Intermediate  90 76.70% 18.90% 1.11% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1004750280 G -> T LOC_Os10g08760.1 upstream_gene_variant ; 1727.0bp to feature; MODIFIER silent_mutation Average:60.741; most accessible tissue: Callus, score: 83.499 N N N N
vg1004750280 G -> T LOC_Os10g08754.1 downstream_gene_variant ; 2840.0bp to feature; MODIFIER silent_mutation Average:60.741; most accessible tissue: Callus, score: 83.499 N N N N
vg1004750280 G -> T LOC_Os10g08760-LOC_Os10g08780 intergenic_region ; MODIFIER silent_mutation Average:60.741; most accessible tissue: Callus, score: 83.499 N N N N
vg1004750280 G -> DEL N N silent_mutation Average:60.741; most accessible tissue: Callus, score: 83.499 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1004750280 NA 4.07E-14 Grain_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1004750280 NA 7.53E-09 mr1023 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004750280 NA 1.24E-14 mr1118 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004750280 NA 5.74E-10 mr1132 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004750280 NA 8.18E-12 mr1390 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004750280 NA 5.68E-12 mr1490 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004750280 NA 4.07E-06 mr1608 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004750280 NA 8.93E-13 mr1055_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004750280 NA 7.14E-08 mr1110_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004750280 NA 2.28E-06 mr1112_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004750280 NA 7.17E-06 mr1113_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004750280 NA 2.85E-06 mr1403_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004750280 NA 1.88E-07 mr1495_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251