| Variant ID: vg1004750280 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 4750280 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 295. )
TTGATACTAGTGATTATCTCGTGGTTATGACTTCTAGATAATTTATATACGTGTGTAACATTGTTTTGTGATAATGTTGAGTCACGCTATGAAAAAATTT[G/T]
TGCTCGGATATTGTTTCTTGTTTGATTCATATGTAGGTGTGTCTTGATGCTTCAGAAGAGTATTGCCAGTGATGGATTAGGAGTCAACTTGAGAGAATAT
ATATTCTCTCAAGTTGACTCCTAATCCATCACTGGCAATACTCTTCTGAAGCATCAAGACACACCTACATATGAATCAAACAAGAAACAATATCCGAGCA[C/A]
AAATTTTTTCATAGCGTGACTCAACATTATCACAAAACAATGTTACACACGTATATAAATTATCTAGAAGTCATAACCACGAGATAATCACTAGTATCAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 80.40% | 14.60% | 0.36% | 4.55% | NA |
| All Indica | 2759 | 88.90% | 6.80% | 0.51% | 3.73% | NA |
| All Japonica | 1512 | 63.80% | 29.80% | 0.13% | 6.22% | NA |
| Aus | 269 | 99.30% | 0.00% | 0.00% | 0.74% | NA |
| Indica I | 595 | 99.70% | 0.00% | 0.00% | 0.34% | NA |
| Indica II | 465 | 87.10% | 12.00% | 0.00% | 0.86% | NA |
| Indica III | 913 | 80.50% | 10.20% | 0.99% | 8.32% | NA |
| Indica Intermediate | 786 | 91.70% | 5.00% | 0.64% | 2.67% | NA |
| Temperate Japonica | 767 | 86.00% | 9.10% | 0.26% | 4.56% | NA |
| Tropical Japonica | 504 | 43.50% | 55.20% | 0.00% | 1.39% | NA |
| Japonica Intermediate | 241 | 35.70% | 42.70% | 0.00% | 21.58% | NA |
| VI/Aromatic | 96 | 49.00% | 37.50% | 0.00% | 13.54% | NA |
| Intermediate | 90 | 76.70% | 18.90% | 1.11% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1004750280 | G -> T | LOC_Os10g08760.1 | upstream_gene_variant ; 1727.0bp to feature; MODIFIER | silent_mutation | Average:60.741; most accessible tissue: Callus, score: 83.499 | N | N | N | N |
| vg1004750280 | G -> T | LOC_Os10g08754.1 | downstream_gene_variant ; 2840.0bp to feature; MODIFIER | silent_mutation | Average:60.741; most accessible tissue: Callus, score: 83.499 | N | N | N | N |
| vg1004750280 | G -> T | LOC_Os10g08760-LOC_Os10g08780 | intergenic_region ; MODIFIER | silent_mutation | Average:60.741; most accessible tissue: Callus, score: 83.499 | N | N | N | N |
| vg1004750280 | G -> DEL | N | N | silent_mutation | Average:60.741; most accessible tissue: Callus, score: 83.499 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1004750280 | NA | 4.07E-14 | Grain_length | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1004750280 | NA | 7.53E-09 | mr1023 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004750280 | NA | 1.24E-14 | mr1118 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004750280 | NA | 5.74E-10 | mr1132 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004750280 | NA | 8.18E-12 | mr1390 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004750280 | NA | 5.68E-12 | mr1490 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004750280 | NA | 4.07E-06 | mr1608 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004750280 | NA | 8.93E-13 | mr1055_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004750280 | NA | 7.14E-08 | mr1110_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004750280 | NA | 2.28E-06 | mr1112_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/