\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1004738097:

Variant ID: vg1004738097 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 4738097
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCTAATCCGATCGAGAGGGGGCGCAGCCAGTGACGGGAATGCGCCACCGCCGCGCCACGCCTGATCGTCGACCACGACTCCCACTGCTACGACCACCGTC[G/A]
CCGTCAAGCACATCGTCGCCGCCGTCCTTGTCAAGCAGAGCGACGACAACGACGATGGCCAGGACTTCCTCCTCATCCAACGCGTCAACCGGTCACATCC

Reverse complement sequence

GGATGTGACCGGTTGACGCGTTGGATGAGGAGGAAGTCCTGGCCATCGTCGTTGTCGTCGCTCTGCTTGACAAGGACGGCGGCGACGATGTGCTTGACGG[C/T]
GACGGTGGTCGTAGCAGTGGGAGTCGTGGTCGACGATCAGGCGTGGCGCGGCGGTGGCGCATTCCCGTCACTGGCTGCGCCCCCTCTCGATCGGATTAGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.30% 4.90% 0.30% 1.57% NA
All Indica  2759 96.40% 0.40% 0.47% 2.65% NA
All Japonica  1512 85.90% 14.10% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.80% 0.00% 0.00% 0.22% NA
Indica III  913 91.00% 1.20% 0.88% 6.90% NA
Indica Intermediate  786 98.10% 0.10% 0.64% 1.15% NA
Temperate Japonica  767 93.50% 6.50% 0.00% 0.00% NA
Tropical Japonica  504 78.60% 21.40% 0.00% 0.00% NA
Japonica Intermediate  241 77.20% 22.80% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 0.00% 1.04% 0.00% NA
Intermediate  90 92.20% 6.70% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1004738097 G -> A LOC_Os10g08720.1 upstream_gene_variant ; 4564.0bp to feature; MODIFIER silent_mutation Average:66.643; most accessible tissue: Minghui63 flag leaf, score: 82.521 N N N N
vg1004738097 G -> A LOC_Os10g08730.1 upstream_gene_variant ; 902.0bp to feature; MODIFIER silent_mutation Average:66.643; most accessible tissue: Minghui63 flag leaf, score: 82.521 N N N N
vg1004738097 G -> A LOC_Os10g08740.1 upstream_gene_variant ; 55.0bp to feature; MODIFIER silent_mutation Average:66.643; most accessible tissue: Minghui63 flag leaf, score: 82.521 N N N N
vg1004738097 G -> A LOC_Os10g08730-LOC_Os10g08740 intergenic_region ; MODIFIER silent_mutation Average:66.643; most accessible tissue: Minghui63 flag leaf, score: 82.521 N N N N
vg1004738097 G -> DEL N N silent_mutation Average:66.643; most accessible tissue: Minghui63 flag leaf, score: 82.521 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1004738097 8.99E-06 NA mr1657 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004738097 NA 3.60E-06 mr1657 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004738097 2.99E-08 NA mr1768 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004738097 4.22E-06 NA mr1768_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004738097 NA 7.73E-07 mr1923_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251