Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1004737301:

Variant ID: vg1004737301 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 4737301
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.00, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:

GCCTACACATTGGCTGCACCAACGACCGAGGCATGACCCAATAAGACTCGGGTCATGTCGAGCTGTCCCAAAGGCACGACAAGCCCACCATGGTCCTTCT[C/T]
GGAATAAGTCTATTTCTCCTCCCTAGTCTATTTGGGATATGTCCTAGGAATTCACTTTGACTCCCTTAACTAGTGACTGAATCTGATTCGTATCCCTGAA

Reverse complement sequence

TTCAGGGATACGAATCAGATTCAGTCACTAGTTAAGGGAGTCAAAGTGAATTCCTAGGACATATCCCAAATAGACTAGGGAGGAGAAATAGACTTATTCC[G/A]
AGAAGGACCATGGTGGGCTTGTCGTGCCTTTGGGACAGCTCGACATGACCCGAGTCTTATTGGGTCATGCCTCGGTCGTTGGTGCAGCCAATGTGTAGGC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	90.30%	8.00%	0.06%	1.65%	NA
All Indica	2759	96.40%	0.80%	0.04%	2.79%	NA
All Japonica	1512	78.70%	21.20%	0.13%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.80%	0.00%	0.00%	0.22%	NA
Indica III	913	91.90%	0.90%	0.11%	7.12%	NA
Indica Intermediate	786	96.90%	1.70%	0.00%	1.40%	NA
Temperate Japonica	767	98.40%	1.40%	0.13%	0.00%	NA
Tropical Japonica	504	55.80%	44.00%	0.20%	0.00%	NA
Japonica Intermediate	241	63.90%	36.10%	0.00%	0.00%	NA
VI/Aromatic	96	76.00%	24.00%	0.00%	0.00%	NA
Intermediate	90	85.60%	13.30%	0.00%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1004737301	C -> T	LOC_Os10g08720.1	upstream_gene_variant ; 3768.0bp to feature; MODIFIER	silent_mutation	Average:69.082; most accessible tissue: Minghui63 young leaf, score: 89.337	N	N	N	N
vg1004737301	C -> T	LOC_Os10g08730.1	upstream_gene_variant ; 106.0bp to feature; MODIFIER	silent_mutation	Average:69.082; most accessible tissue: Minghui63 young leaf, score: 89.337	N	N	N	N
vg1004737301	C -> T	LOC_Os10g08740.1	upstream_gene_variant ; 851.0bp to feature; MODIFIER	silent_mutation	Average:69.082; most accessible tissue: Minghui63 young leaf, score: 89.337	N	N	N	N
vg1004737301	C -> T	LOC_Os10g08730-LOC_Os10g08740	intergenic_region ; MODIFIER	silent_mutation	Average:69.082; most accessible tissue: Minghui63 young leaf, score: 89.337	N	N	N	N
vg1004737301	C -> DEL	N	N	silent_mutation	Average:69.082; most accessible tissue: Minghui63 young leaf, score: 89.337	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1004737301	NA	1.73E-06	mr1119	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004737301	NA	7.69E-07	mr1206	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004737301	NA	8.81E-06	mr1448	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004737301	NA	1.92E-09	mr1570	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004737301	4.72E-06	NA	mr1828	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004737301	NA	1.77E-07	mr1961	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004737301	NA	3.90E-06	mr1077_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004737301	1.46E-06	1.46E-06	mr1312_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004737301	NA	2.78E-06	mr1397_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004737301	NA	7.07E-06	mr1556_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004737301	3.20E-06	3.20E-06	mr1663_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004737301	NA	2.08E-06	mr1665_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004737301	8.19E-06	8.19E-06	mr1674_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004737301	NA	5.64E-07	mr1738_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004737301	NA	2.11E-06	mr1812_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004737301	6.59E-06	6.59E-06	mr1847_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004737301	4.04E-06	NA	mr1961_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251