\
| Variant ID: vg1004737301 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 4737301 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.00, others allele: 0.00, population size: 259. )
GCCTACACATTGGCTGCACCAACGACCGAGGCATGACCCAATAAGACTCGGGTCATGTCGAGCTGTCCCAAAGGCACGACAAGCCCACCATGGTCCTTCT[C/T]
GGAATAAGTCTATTTCTCCTCCCTAGTCTATTTGGGATATGTCCTAGGAATTCACTTTGACTCCCTTAACTAGTGACTGAATCTGATTCGTATCCCTGAA
TTCAGGGATACGAATCAGATTCAGTCACTAGTTAAGGGAGTCAAAGTGAATTCCTAGGACATATCCCAAATAGACTAGGGAGGAGAAATAGACTTATTCC[G/A]
AGAAGGACCATGGTGGGCTTGTCGTGCCTTTGGGACAGCTCGACATGACCCGAGTCTTATTGGGTCATGCCTCGGTCGTTGGTGCAGCCAATGTGTAGGC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 90.30% | 8.00% | 0.06% | 1.65% | NA |
| All Indica | 2759 | 96.40% | 0.80% | 0.04% | 2.79% | NA |
| All Japonica | 1512 | 78.70% | 21.20% | 0.13% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.00% | 0.00% | 0.22% | NA |
| Indica III | 913 | 91.90% | 0.90% | 0.11% | 7.12% | NA |
| Indica Intermediate | 786 | 96.90% | 1.70% | 0.00% | 1.40% | NA |
| Temperate Japonica | 767 | 98.40% | 1.40% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 55.80% | 44.00% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 63.90% | 36.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 76.00% | 24.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 85.60% | 13.30% | 0.00% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1004737301 | C -> T | LOC_Os10g08720.1 | upstream_gene_variant ; 3768.0bp to feature; MODIFIER | silent_mutation | Average:69.082; most accessible tissue: Minghui63 young leaf, score: 89.337 | N | N | N | N |
| vg1004737301 | C -> T | LOC_Os10g08730.1 | upstream_gene_variant ; 106.0bp to feature; MODIFIER | silent_mutation | Average:69.082; most accessible tissue: Minghui63 young leaf, score: 89.337 | N | N | N | N |
| vg1004737301 | C -> T | LOC_Os10g08740.1 | upstream_gene_variant ; 851.0bp to feature; MODIFIER | silent_mutation | Average:69.082; most accessible tissue: Minghui63 young leaf, score: 89.337 | N | N | N | N |
| vg1004737301 | C -> T | LOC_Os10g08730-LOC_Os10g08740 | intergenic_region ; MODIFIER | silent_mutation | Average:69.082; most accessible tissue: Minghui63 young leaf, score: 89.337 | N | N | N | N |
| vg1004737301 | C -> DEL | N | N | silent_mutation | Average:69.082; most accessible tissue: Minghui63 young leaf, score: 89.337 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1004737301 | NA | 1.73E-06 | mr1119 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004737301 | NA | 7.69E-07 | mr1206 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004737301 | NA | 8.81E-06 | mr1448 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004737301 | NA | 1.92E-09 | mr1570 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004737301 | 4.72E-06 | NA | mr1828 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004737301 | NA | 1.77E-07 | mr1961 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004737301 | NA | 3.90E-06 | mr1077_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004737301 | 1.46E-06 | 1.46E-06 | mr1312_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004737301 | NA | 2.78E-06 | mr1397_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004737301 | NA | 7.07E-06 | mr1556_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004737301 | 3.20E-06 | 3.20E-06 | mr1663_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004737301 | NA | 2.08E-06 | mr1665_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004737301 | 8.19E-06 | 8.19E-06 | mr1674_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004737301 | NA | 5.64E-07 | mr1738_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004737301 | NA | 2.11E-06 | mr1812_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004737301 | 6.59E-06 | 6.59E-06 | mr1847_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004737301 | 4.04E-06 | NA | mr1961_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |