\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1004737301:

Variant ID: vg1004737301 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 4737301
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.00, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:


GCCTACACATTGGCTGCACCAACGACCGAGGCATGACCCAATAAGACTCGGGTCATGTCGAGCTGTCCCAAAGGCACGACAAGCCCACCATGGTCCTTCT[C/T]
GGAATAAGTCTATTTCTCCTCCCTAGTCTATTTGGGATATGTCCTAGGAATTCACTTTGACTCCCTTAACTAGTGACTGAATCTGATTCGTATCCCTGAA

Reverse complement sequence

TTCAGGGATACGAATCAGATTCAGTCACTAGTTAAGGGAGTCAAAGTGAATTCCTAGGACATATCCCAAATAGACTAGGGAGGAGAAATAGACTTATTCC[G/A]
AGAAGGACCATGGTGGGCTTGTCGTGCCTTTGGGACAGCTCGACATGACCCGAGTCTTATTGGGTCATGCCTCGGTCGTTGGTGCAGCCAATGTGTAGGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.30% 8.00% 0.06% 1.65% NA
All Indica  2759 96.40% 0.80% 0.04% 2.79% NA
All Japonica  1512 78.70% 21.20% 0.13% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.80% 0.00% 0.00% 0.22% NA
Indica III  913 91.90% 0.90% 0.11% 7.12% NA
Indica Intermediate  786 96.90% 1.70% 0.00% 1.40% NA
Temperate Japonica  767 98.40% 1.40% 0.13% 0.00% NA
Tropical Japonica  504 55.80% 44.00% 0.20% 0.00% NA
Japonica Intermediate  241 63.90% 36.10% 0.00% 0.00% NA
VI/Aromatic  96 76.00% 24.00% 0.00% 0.00% NA
Intermediate  90 85.60% 13.30% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1004737301 C -> T LOC_Os10g08720.1 upstream_gene_variant ; 3768.0bp to feature; MODIFIER silent_mutation Average:69.082; most accessible tissue: Minghui63 young leaf, score: 89.337 N N N N
vg1004737301 C -> T LOC_Os10g08730.1 upstream_gene_variant ; 106.0bp to feature; MODIFIER silent_mutation Average:69.082; most accessible tissue: Minghui63 young leaf, score: 89.337 N N N N
vg1004737301 C -> T LOC_Os10g08740.1 upstream_gene_variant ; 851.0bp to feature; MODIFIER silent_mutation Average:69.082; most accessible tissue: Minghui63 young leaf, score: 89.337 N N N N
vg1004737301 C -> T LOC_Os10g08730-LOC_Os10g08740 intergenic_region ; MODIFIER silent_mutation Average:69.082; most accessible tissue: Minghui63 young leaf, score: 89.337 N N N N
vg1004737301 C -> DEL N N silent_mutation Average:69.082; most accessible tissue: Minghui63 young leaf, score: 89.337 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1004737301 NA 1.73E-06 mr1119 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004737301 NA 7.69E-07 mr1206 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004737301 NA 8.81E-06 mr1448 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004737301 NA 1.92E-09 mr1570 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004737301 4.72E-06 NA mr1828 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004737301 NA 1.77E-07 mr1961 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004737301 NA 3.90E-06 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004737301 1.46E-06 1.46E-06 mr1312_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004737301 NA 2.78E-06 mr1397_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004737301 NA 7.07E-06 mr1556_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004737301 3.20E-06 3.20E-06 mr1663_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004737301 NA 2.08E-06 mr1665_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004737301 8.19E-06 8.19E-06 mr1674_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004737301 NA 5.64E-07 mr1738_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004737301 NA 2.11E-06 mr1812_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004737301 6.59E-06 6.59E-06 mr1847_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004737301 4.04E-06 NA mr1961_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251