Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1004715734:

Variant ID: vg1004715734 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 4715734
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.90, C: 0.11, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:

CTTTCTGAGGTACCGTGGTGGTATCGAGGCGCATGGTGACATGTTGTGGGGCTGTGTCTTGTGGGTTCAGTGGTACATCTCTGGCCAGAGTAAAACTATT[T/C]
GAATAGCCGTGCCCGCGGTTCTGGGCGGGTCTAACAATGTCTTTCGTGATTAGTTTCACACTTCTCATCATAATAGAAGATGCTATAACTGGTAATAATT

Reverse complement sequence

AATTATTACCAGTTATAGCATCTTCTATTATGATGAGAAGTGTGAAACTAATCACGAAAGACATTGTTAGACCCGCCCAGAACCGCGGGCACGGCTATTC[A/G]
AATAGTTTTACTCTGGCCAGAGATGTACCACTGAACCCACAAGACACAGCCCCACAACATGTCACCATGCGCCTCGATACCACCACGGTACCTCAGAAAG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	16.40%	1.50%	25.05%	57.09%	NA
All Indica	2759	1.60%	2.10%	20.15%	76.08%	NA
All Japonica	1512	45.80%	0.80%	35.05%	18.32%	NA
Aus	269	1.50%	0.00%	4.83%	93.68%	NA
Indica I	595	1.30%	0.50%	5.71%	92.44%	NA
Indica II	465	1.10%	1.70%	20.00%	77.20%	NA
Indica III	913	1.30%	3.40%	33.41%	61.88%	NA
Indica Intermediate	786	2.50%	2.20%	15.78%	79.52%	NA
Temperate Japonica	767	82.00%	0.10%	6.78%	11.08%	NA
Tropical Japonica	504	3.40%	1.40%	75.40%	19.84%	NA
Japonica Intermediate	241	19.50%	1.70%	40.66%	38.17%	NA
VI/Aromatic	96	18.80%	0.00%	59.38%	21.88%	NA
Intermediate	90	14.40%	0.00%	31.11%	54.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1004715734	T -> C	LOC_Os10g08690.1	upstream_gene_variant ; 811.0bp to feature; MODIFIER	silent_mutation	Average:20.545; most accessible tissue: Minghui63 young leaf, score: 45.896	N	N	N	N
vg1004715734	T -> C	LOC_Os10g08702.1	upstream_gene_variant ; 2239.0bp to feature; MODIFIER	silent_mutation	Average:20.545; most accessible tissue: Minghui63 young leaf, score: 45.896	N	N	N	N
vg1004715734	T -> C	LOC_Os10g08680.1	downstream_gene_variant ; 1753.0bp to feature; MODIFIER	silent_mutation	Average:20.545; most accessible tissue: Minghui63 young leaf, score: 45.896	N	N	N	N
vg1004715734	T -> C	LOC_Os10g08696.1	intron_variant ; MODIFIER	silent_mutation	Average:20.545; most accessible tissue: Minghui63 young leaf, score: 45.896	N	N	N	N
vg1004715734	T -> DEL	N	N	silent_mutation	Average:20.545; most accessible tissue: Minghui63 young leaf, score: 45.896	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1004715734	NA	8.54E-06	mr1047	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004715734	NA	2.15E-06	mr1118	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004715734	NA	7.84E-06	mr1300	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004715734	NA	2.81E-07	mr1310	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004715734	NA	6.81E-07	mr1870	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004715734	NA	8.96E-08	mr1310_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004715734	9.19E-07	9.19E-07	mr1335_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004715734	NA	4.32E-06	mr1959_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251