\
| Variant ID: vg1004690394 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 4690394 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 119. )
AGGGTGAGCTCGTCCTTCTCTCTGTCGGGCCGGAAAGTCCCCTGCGTAGAGGCTTCAATTGCATCCGCAAGTCAGCGTGCTGCATCTCGAATCTCATCGC[C/T]
GAATATGAGGGAGCCATCACCTGGATTGAGCGATCCACCGTGTGCATAGAACCAGTTCCTCGATCGCGCAGGCCAATTAGCCGTGGCCGGCTTGATACCC
GGGTATCAAGCCGGCCACGGCTAATTGGCCTGCGCGATCGAGGAACTGGTTCTATGCACACGGTGGATCGCTCAATCCAGGTGATGGCTCCCTCATATTC[G/A]
GCGATGAGATTCGAGATGCAGCACGCTGACTTGCGGATGCAATTGAAGCCTCTACGCAGGGGACTTTCCGGCCCGACAGAGAGAAGGACGAGCTCACCCT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 72.50% | 7.70% | 15.51% | 4.34% | NA |
| All Indica | 2759 | 59.80% | 12.30% | 21.09% | 6.78% | NA |
| All Japonica | 1512 | 90.10% | 1.10% | 8.60% | 0.13% | NA |
| Aus | 269 | 95.20% | 0.40% | 0.74% | 3.72% | NA |
| Indica I | 595 | 58.30% | 15.80% | 20.84% | 5.04% | NA |
| Indica II | 465 | 54.80% | 11.20% | 29.03% | 4.95% | NA |
| Indica III | 913 | 61.10% | 11.80% | 17.74% | 9.31% | NA |
| Indica Intermediate | 786 | 62.50% | 10.80% | 20.48% | 6.23% | NA |
| Temperate Japonica | 767 | 94.90% | 0.80% | 4.04% | 0.26% | NA |
| Tropical Japonica | 504 | 82.50% | 1.80% | 15.67% | 0.00% | NA |
| Japonica Intermediate | 241 | 90.90% | 0.80% | 8.30% | 0.00% | NA |
| VI/Aromatic | 96 | 95.80% | 1.00% | 0.00% | 3.12% | NA |
| Intermediate | 90 | 68.90% | 6.70% | 21.11% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1004690394 | C -> T | LOC_Os10g08650.1 | upstream_gene_variant ; 327.0bp to feature; MODIFIER | silent_mutation | Average:25.271; most accessible tissue: Minghui63 flag leaf, score: 38.136 | N | N | N | N |
| vg1004690394 | C -> T | LOC_Os10g08640.1 | downstream_gene_variant ; 3932.0bp to feature; MODIFIER | silent_mutation | Average:25.271; most accessible tissue: Minghui63 flag leaf, score: 38.136 | N | N | N | N |
| vg1004690394 | C -> T | LOC_Os10g08660.1 | downstream_gene_variant ; 320.0bp to feature; MODIFIER | silent_mutation | Average:25.271; most accessible tissue: Minghui63 flag leaf, score: 38.136 | N | N | N | N |
| vg1004690394 | C -> T | LOC_Os10g08650-LOC_Os10g08660 | intergenic_region ; MODIFIER | silent_mutation | Average:25.271; most accessible tissue: Minghui63 flag leaf, score: 38.136 | N | N | N | N |
| vg1004690394 | C -> DEL | N | N | silent_mutation | Average:25.271; most accessible tissue: Minghui63 flag leaf, score: 38.136 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1004690394 | 4.69E-06 | 4.69E-06 | mr1289_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004690394 | 7.19E-06 | 7.19E-06 | mr1313_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004690394 | 8.69E-06 | 8.69E-06 | mr1433_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004690394 | 2.36E-06 | 2.36E-06 | mr1473_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004690394 | 7.21E-06 | 7.21E-06 | mr1630_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004690394 | NA | 7.31E-07 | mr1691_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |