\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1004690394:

Variant ID: vg1004690394 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 4690394
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 119. )

Flanking Sequence (100 bp) in Reference Genome:


AGGGTGAGCTCGTCCTTCTCTCTGTCGGGCCGGAAAGTCCCCTGCGTAGAGGCTTCAATTGCATCCGCAAGTCAGCGTGCTGCATCTCGAATCTCATCGC[C/T]
GAATATGAGGGAGCCATCACCTGGATTGAGCGATCCACCGTGTGCATAGAACCAGTTCCTCGATCGCGCAGGCCAATTAGCCGTGGCCGGCTTGATACCC

Reverse complement sequence

GGGTATCAAGCCGGCCACGGCTAATTGGCCTGCGCGATCGAGGAACTGGTTCTATGCACACGGTGGATCGCTCAATCCAGGTGATGGCTCCCTCATATTC[G/A]
GCGATGAGATTCGAGATGCAGCACGCTGACTTGCGGATGCAATTGAAGCCTCTACGCAGGGGACTTTCCGGCCCGACAGAGAGAAGGACGAGCTCACCCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 72.50% 7.70% 15.51% 4.34% NA
All Indica  2759 59.80% 12.30% 21.09% 6.78% NA
All Japonica  1512 90.10% 1.10% 8.60% 0.13% NA
Aus  269 95.20% 0.40% 0.74% 3.72% NA
Indica I  595 58.30% 15.80% 20.84% 5.04% NA
Indica II  465 54.80% 11.20% 29.03% 4.95% NA
Indica III  913 61.10% 11.80% 17.74% 9.31% NA
Indica Intermediate  786 62.50% 10.80% 20.48% 6.23% NA
Temperate Japonica  767 94.90% 0.80% 4.04% 0.26% NA
Tropical Japonica  504 82.50% 1.80% 15.67% 0.00% NA
Japonica Intermediate  241 90.90% 0.80% 8.30% 0.00% NA
VI/Aromatic  96 95.80% 1.00% 0.00% 3.12% NA
Intermediate  90 68.90% 6.70% 21.11% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1004690394 C -> T LOC_Os10g08650.1 upstream_gene_variant ; 327.0bp to feature; MODIFIER silent_mutation Average:25.271; most accessible tissue: Minghui63 flag leaf, score: 38.136 N N N N
vg1004690394 C -> T LOC_Os10g08640.1 downstream_gene_variant ; 3932.0bp to feature; MODIFIER silent_mutation Average:25.271; most accessible tissue: Minghui63 flag leaf, score: 38.136 N N N N
vg1004690394 C -> T LOC_Os10g08660.1 downstream_gene_variant ; 320.0bp to feature; MODIFIER silent_mutation Average:25.271; most accessible tissue: Minghui63 flag leaf, score: 38.136 N N N N
vg1004690394 C -> T LOC_Os10g08650-LOC_Os10g08660 intergenic_region ; MODIFIER silent_mutation Average:25.271; most accessible tissue: Minghui63 flag leaf, score: 38.136 N N N N
vg1004690394 C -> DEL N N silent_mutation Average:25.271; most accessible tissue: Minghui63 flag leaf, score: 38.136 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1004690394 4.69E-06 4.69E-06 mr1289_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004690394 7.19E-06 7.19E-06 mr1313_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004690394 8.69E-06 8.69E-06 mr1433_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004690394 2.36E-06 2.36E-06 mr1473_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004690394 7.21E-06 7.21E-06 mr1630_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004690394 NA 7.31E-07 mr1691_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251