Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1004654643:

Variant ID: vg1004654643 (JBrowse)	Variation Type: INDEL
Chromosome: chr10	Position: 4654643
Reference Allele: T	Alternative Allele: A,TA
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.91, A: 0.09, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:

ATTTAAATTGAATGCTTTGAATTTTGAGATGAAATTTTTTAAATTTGAGTTAAAAGTTTTCAAACCTGAGTTAAATTTTCAATCTCGACTTGATTTTTTT[T/A,TA]
AAATTTGAGTTTGATGTTTTCAACTCTGAGTTAAAAATTTTCAAATCTTCATTGAAAGTTTTTAAATCGGAGTTGAAAATTTCAAAAAGTTCAAAATCTT

Reverse complement sequence

AAGATTTTGAACTTTTTGAAATTTTCAACTCCGATTTAAAAACTTTCAATGAAGATTTGAAAATTTTTAACTCAGAGTTGAAAACATCAAACTCAAATTT[A/T,TA]
AAAAAAATCAAGTCGAGATTGAAAATTTAACTCAGGTTTGAAAACTTTTAACTCAAATTTAAAAAATTTCATCTCAAAATTCAAAGCATTCAATTTAAAT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	56.90%	41.40%	1.61%	0.00%	TA: 0.08%
All Indica	2759	40.70%	57.60%	1.56%	0.00%	TA: 0.07%
All Japonica	1512	94.40%	3.60%	1.98%	0.00%	NA
Aus	269	1.90%	97.00%	0.37%	0.00%	TA: 0.74%
Indica I	595	33.30%	63.40%	3.36%	0.00%	NA
Indica II	465	28.40%	69.90%	1.72%	0.00%	NA
Indica III	913	56.40%	43.00%	0.55%	0.00%	NA
Indica Intermediate	786	35.50%	63.00%	1.27%	0.00%	TA: 0.25%
Temperate Japonica	767	92.40%	4.00%	3.52%	0.00%	NA
Tropical Japonica	504	98.00%	2.00%	0.00%	0.00%	NA
Japonica Intermediate	241	93.40%	5.40%	1.24%	0.00%	NA
VI/Aromatic	96	80.20%	19.80%	0.00%	0.00%	NA
Intermediate	90	63.30%	34.40%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1004654643	T -> TA	LOC_Os10g08570.1	upstream_gene_variant ; 1012.0bp to feature; MODIFIER	silent_mutation	Average:22.946; most accessible tissue: Minghui63 panicle, score: 34.226	N	N	N	N
vg1004654643	T -> TA	LOC_Os10g08560.1	downstream_gene_variant ; 182.0bp to feature; MODIFIER	silent_mutation	Average:22.946; most accessible tissue: Minghui63 panicle, score: 34.226	N	N	N	N
vg1004654643	T -> TA	LOC_Os10g08560-LOC_Os10g08570	intergenic_region ; MODIFIER	silent_mutation	Average:22.946; most accessible tissue: Minghui63 panicle, score: 34.226	N	N	N	N
vg1004654643	T -> A	LOC_Os10g08570.1	upstream_gene_variant ; 1013.0bp to feature; MODIFIER	silent_mutation	Average:22.946; most accessible tissue: Minghui63 panicle, score: 34.226	N	N	N	N
vg1004654643	T -> A	LOC_Os10g08560.1	downstream_gene_variant ; 181.0bp to feature; MODIFIER	silent_mutation	Average:22.946; most accessible tissue: Minghui63 panicle, score: 34.226	N	N	N	N
vg1004654643	T -> A	LOC_Os10g08560-LOC_Os10g08570	intergenic_region ; MODIFIER	silent_mutation	Average:22.946; most accessible tissue: Minghui63 panicle, score: 34.226	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1004654643	NA	1.38E-10	mr1128	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004654643	NA	4.78E-07	mr1220	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004654643	NA	4.56E-10	mr1232	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004654643	NA	3.28E-07	mr1245	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004654643	NA	2.26E-08	mr1424	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004654643	NA	1.14E-06	mr1445	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004654643	NA	1.35E-09	mr1575	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004654643	NA	4.85E-06	mr1633	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004654643	NA	2.89E-14	mr1653	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004654643	9.14E-06	6.65E-15	mr1853	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004654643	2.53E-08	2.53E-08	mr1853	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004654643	NA	3.01E-06	mr1881	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004654643	NA	1.72E-14	mr1909	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004654643	NA	3.54E-11	mr1921	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004654643	NA	2.06E-06	mr1960	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004654643	NA	1.18E-12	mr1128_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004654643	NA	3.00E-06	mr1128_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004654643	NA	2.49E-06	mr1308_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004654643	2.05E-06	NA	mr1327_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004654643	3.53E-06	1.42E-08	mr1327_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251