\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1004654643:

Variant ID: vg1004654643 (JBrowse)Variation Type: INDEL
Chromosome: chr10Position: 4654643
Reference Allele: TAlternative Allele: A,TA
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.91, A: 0.09, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


ATTTAAATTGAATGCTTTGAATTTTGAGATGAAATTTTTTAAATTTGAGTTAAAAGTTTTCAAACCTGAGTTAAATTTTCAATCTCGACTTGATTTTTTT[T/A,TA]
AAATTTGAGTTTGATGTTTTCAACTCTGAGTTAAAAATTTTCAAATCTTCATTGAAAGTTTTTAAATCGGAGTTGAAAATTTCAAAAAGTTCAAAATCTT

Reverse complement sequence

AAGATTTTGAACTTTTTGAAATTTTCAACTCCGATTTAAAAACTTTCAATGAAGATTTGAAAATTTTTAACTCAGAGTTGAAAACATCAAACTCAAATTT[A/T,TA]
AAAAAAATCAAGTCGAGATTGAAAATTTAACTCAGGTTTGAAAACTTTTAACTCAAATTTAAAAAATTTCATCTCAAAATTCAAAGCATTCAATTTAAAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.90% 41.40% 1.61% 0.00% TA: 0.08%
All Indica  2759 40.70% 57.60% 1.56% 0.00% TA: 0.07%
All Japonica  1512 94.40% 3.60% 1.98% 0.00% NA
Aus  269 1.90% 97.00% 0.37% 0.00% TA: 0.74%
Indica I  595 33.30% 63.40% 3.36% 0.00% NA
Indica II  465 28.40% 69.90% 1.72% 0.00% NA
Indica III  913 56.40% 43.00% 0.55% 0.00% NA
Indica Intermediate  786 35.50% 63.00% 1.27% 0.00% TA: 0.25%
Temperate Japonica  767 92.40% 4.00% 3.52% 0.00% NA
Tropical Japonica  504 98.00% 2.00% 0.00% 0.00% NA
Japonica Intermediate  241 93.40% 5.40% 1.24% 0.00% NA
VI/Aromatic  96 80.20% 19.80% 0.00% 0.00% NA
Intermediate  90 63.30% 34.40% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1004654643 T -> TA LOC_Os10g08570.1 upstream_gene_variant ; 1012.0bp to feature; MODIFIER silent_mutation Average:22.946; most accessible tissue: Minghui63 panicle, score: 34.226 N N N N
vg1004654643 T -> TA LOC_Os10g08560.1 downstream_gene_variant ; 182.0bp to feature; MODIFIER silent_mutation Average:22.946; most accessible tissue: Minghui63 panicle, score: 34.226 N N N N
vg1004654643 T -> TA LOC_Os10g08560-LOC_Os10g08570 intergenic_region ; MODIFIER silent_mutation Average:22.946; most accessible tissue: Minghui63 panicle, score: 34.226 N N N N
vg1004654643 T -> A LOC_Os10g08570.1 upstream_gene_variant ; 1013.0bp to feature; MODIFIER silent_mutation Average:22.946; most accessible tissue: Minghui63 panicle, score: 34.226 N N N N
vg1004654643 T -> A LOC_Os10g08560.1 downstream_gene_variant ; 181.0bp to feature; MODIFIER silent_mutation Average:22.946; most accessible tissue: Minghui63 panicle, score: 34.226 N N N N
vg1004654643 T -> A LOC_Os10g08560-LOC_Os10g08570 intergenic_region ; MODIFIER silent_mutation Average:22.946; most accessible tissue: Minghui63 panicle, score: 34.226 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1004654643 NA 1.38E-10 mr1128 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004654643 NA 4.78E-07 mr1220 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004654643 NA 4.56E-10 mr1232 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004654643 NA 3.28E-07 mr1245 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004654643 NA 2.26E-08 mr1424 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004654643 NA 1.14E-06 mr1445 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004654643 NA 1.35E-09 mr1575 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004654643 NA 4.85E-06 mr1633 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004654643 NA 2.89E-14 mr1653 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004654643 9.14E-06 6.65E-15 mr1853 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004654643 2.53E-08 2.53E-08 mr1853 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004654643 NA 3.01E-06 mr1881 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004654643 NA 1.72E-14 mr1909 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004654643 NA 3.54E-11 mr1921 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004654643 NA 2.06E-06 mr1960 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004654643 NA 1.18E-12 mr1128_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004654643 NA 3.00E-06 mr1128_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004654643 NA 2.49E-06 mr1308_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004654643 2.05E-06 NA mr1327_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004654643 3.53E-06 1.42E-08 mr1327_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251