\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1004652594:

Variant ID: vg1004652594 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 4652594
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.70, G: 0.29, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:


ATGTCGTGGTGGCATGTCGGCGCACGGAAATGTGTCGTGGGGCTGTGTCTTGTGGGTACAGTTGTACATCTCTGATCAGAGTAAAACTATTCGAATAGCC[A/G]
TGCCTGCGGTTATGGGCGGTCAACCAGATTCACCGTGATTAGTCTCACCCTAGTGTAATCTTTTGAAATTGGATAGTTTAGGTGGATGGTTGGGCCTGTC

Reverse complement sequence

GACAGGCCCAACCATCCACCTAAACTATCCAATTTCAAAAGATTACACTAGGGTGAGACTAATCACGGTGAATCTGGTTGACCGCCCATAACCGCAGGCA[T/C]
GGCTATTCGAATAGTTTTACTCTGATCAGAGATGTACAACTGTACCCACAAGACACAGCCCCACGACACATTTCCGTGCGCCGACATGCCACCACGACAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.90% 0.10% 6.58% 32.35% NA
All Indica  2759 57.80% 0.20% 4.75% 37.22% NA
All Japonica  1512 63.80% 0.00% 10.45% 25.73% NA
Aus  269 71.00% 0.00% 2.97% 26.02% NA
Indica I  595 50.60% 0.20% 6.89% 42.35% NA
Indica II  465 65.60% 0.60% 2.37% 31.40% NA
Indica III  913 61.70% 0.00% 5.48% 32.86% NA
Indica Intermediate  786 54.20% 0.30% 3.69% 41.86% NA
Temperate Japonica  767 89.70% 0.00% 0.91% 9.39% NA
Tropical Japonica  504 26.00% 0.00% 27.18% 46.83% NA
Japonica Intermediate  241 60.60% 0.00% 5.81% 33.61% NA
VI/Aromatic  96 67.70% 1.00% 7.29% 23.96% NA
Intermediate  90 70.00% 0.00% 7.78% 22.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1004652594 A -> G LOC_Os10g08560.1 upstream_gene_variant ; 1085.0bp to feature; MODIFIER silent_mutation Average:36.909; most accessible tissue: Zhenshan97 flag leaf, score: 71.63 N N N N
vg1004652594 A -> G LOC_Os10g08570.1 upstream_gene_variant ; 3062.0bp to feature; MODIFIER silent_mutation Average:36.909; most accessible tissue: Zhenshan97 flag leaf, score: 71.63 N N N N
vg1004652594 A -> G LOC_Os10g08550-LOC_Os10g08560 intergenic_region ; MODIFIER silent_mutation Average:36.909; most accessible tissue: Zhenshan97 flag leaf, score: 71.63 N N N N
vg1004652594 A -> DEL N N silent_mutation Average:36.909; most accessible tissue: Zhenshan97 flag leaf, score: 71.63 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1004652594 NA 1.74E-06 mr1471 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004652594 NA 4.92E-07 mr1808 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004652594 NA 2.86E-06 mr1830 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004652594 NA 5.43E-06 mr1308_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004652594 1.34E-06 NA mr1723_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004652594 NA 1.19E-06 mr1723_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004652594 NA 1.17E-12 mr1853_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004652594 8.18E-06 8.18E-06 mr1853_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251