\
| Variant ID: vg1004652594 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 4652594 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.70, G: 0.29, others allele: 0.00, population size: 80. )
ATGTCGTGGTGGCATGTCGGCGCACGGAAATGTGTCGTGGGGCTGTGTCTTGTGGGTACAGTTGTACATCTCTGATCAGAGTAAAACTATTCGAATAGCC[A/G]
TGCCTGCGGTTATGGGCGGTCAACCAGATTCACCGTGATTAGTCTCACCCTAGTGTAATCTTTTGAAATTGGATAGTTTAGGTGGATGGTTGGGCCTGTC
GACAGGCCCAACCATCCACCTAAACTATCCAATTTCAAAAGATTACACTAGGGTGAGACTAATCACGGTGAATCTGGTTGACCGCCCATAACCGCAGGCA[T/C]
GGCTATTCGAATAGTTTTACTCTGATCAGAGATGTACAACTGTACCCACAAGACACAGCCCCACGACACATTTCCGTGCGCCGACATGCCACCACGACAT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 60.90% | 0.10% | 6.58% | 32.35% | NA |
| All Indica | 2759 | 57.80% | 0.20% | 4.75% | 37.22% | NA |
| All Japonica | 1512 | 63.80% | 0.00% | 10.45% | 25.73% | NA |
| Aus | 269 | 71.00% | 0.00% | 2.97% | 26.02% | NA |
| Indica I | 595 | 50.60% | 0.20% | 6.89% | 42.35% | NA |
| Indica II | 465 | 65.60% | 0.60% | 2.37% | 31.40% | NA |
| Indica III | 913 | 61.70% | 0.00% | 5.48% | 32.86% | NA |
| Indica Intermediate | 786 | 54.20% | 0.30% | 3.69% | 41.86% | NA |
| Temperate Japonica | 767 | 89.70% | 0.00% | 0.91% | 9.39% | NA |
| Tropical Japonica | 504 | 26.00% | 0.00% | 27.18% | 46.83% | NA |
| Japonica Intermediate | 241 | 60.60% | 0.00% | 5.81% | 33.61% | NA |
| VI/Aromatic | 96 | 67.70% | 1.00% | 7.29% | 23.96% | NA |
| Intermediate | 90 | 70.00% | 0.00% | 7.78% | 22.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1004652594 | A -> G | LOC_Os10g08560.1 | upstream_gene_variant ; 1085.0bp to feature; MODIFIER | silent_mutation | Average:36.909; most accessible tissue: Zhenshan97 flag leaf, score: 71.63 | N | N | N | N |
| vg1004652594 | A -> G | LOC_Os10g08570.1 | upstream_gene_variant ; 3062.0bp to feature; MODIFIER | silent_mutation | Average:36.909; most accessible tissue: Zhenshan97 flag leaf, score: 71.63 | N | N | N | N |
| vg1004652594 | A -> G | LOC_Os10g08550-LOC_Os10g08560 | intergenic_region ; MODIFIER | silent_mutation | Average:36.909; most accessible tissue: Zhenshan97 flag leaf, score: 71.63 | N | N | N | N |
| vg1004652594 | A -> DEL | N | N | silent_mutation | Average:36.909; most accessible tissue: Zhenshan97 flag leaf, score: 71.63 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1004652594 | NA | 1.74E-06 | mr1471 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004652594 | NA | 4.92E-07 | mr1808 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004652594 | NA | 2.86E-06 | mr1830 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004652594 | NA | 5.43E-06 | mr1308_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004652594 | 1.34E-06 | NA | mr1723_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004652594 | NA | 1.19E-06 | mr1723_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004652594 | NA | 1.17E-12 | mr1853_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004652594 | 8.18E-06 | 8.18E-06 | mr1853_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |