Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1004652594:

Variant ID: vg1004652594 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 4652594
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.70, G: 0.29, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:

ATGTCGTGGTGGCATGTCGGCGCACGGAAATGTGTCGTGGGGCTGTGTCTTGTGGGTACAGTTGTACATCTCTGATCAGAGTAAAACTATTCGAATAGCC[A/G]
TGCCTGCGGTTATGGGCGGTCAACCAGATTCACCGTGATTAGTCTCACCCTAGTGTAATCTTTTGAAATTGGATAGTTTAGGTGGATGGTTGGGCCTGTC

Reverse complement sequence

GACAGGCCCAACCATCCACCTAAACTATCCAATTTCAAAAGATTACACTAGGGTGAGACTAATCACGGTGAATCTGGTTGACCGCCCATAACCGCAGGCA[T/C]
GGCTATTCGAATAGTTTTACTCTGATCAGAGATGTACAACTGTACCCACAAGACACAGCCCCACGACACATTTCCGTGCGCCGACATGCCACCACGACAT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	60.90%	0.10%	6.58%	32.35%	NA
All Indica	2759	57.80%	0.20%	4.75%	37.22%	NA
All Japonica	1512	63.80%	0.00%	10.45%	25.73%	NA
Aus	269	71.00%	0.00%	2.97%	26.02%	NA
Indica I	595	50.60%	0.20%	6.89%	42.35%	NA
Indica II	465	65.60%	0.60%	2.37%	31.40%	NA
Indica III	913	61.70%	0.00%	5.48%	32.86%	NA
Indica Intermediate	786	54.20%	0.30%	3.69%	41.86%	NA
Temperate Japonica	767	89.70%	0.00%	0.91%	9.39%	NA
Tropical Japonica	504	26.00%	0.00%	27.18%	46.83%	NA
Japonica Intermediate	241	60.60%	0.00%	5.81%	33.61%	NA
VI/Aromatic	96	67.70%	1.00%	7.29%	23.96%	NA
Intermediate	90	70.00%	0.00%	7.78%	22.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1004652594	A -> G	LOC_Os10g08560.1	upstream_gene_variant ; 1085.0bp to feature; MODIFIER	silent_mutation	Average:36.909; most accessible tissue: Zhenshan97 flag leaf, score: 71.63	N	N	N	N
vg1004652594	A -> G	LOC_Os10g08570.1	upstream_gene_variant ; 3062.0bp to feature; MODIFIER	silent_mutation	Average:36.909; most accessible tissue: Zhenshan97 flag leaf, score: 71.63	N	N	N	N
vg1004652594	A -> G	LOC_Os10g08550-LOC_Os10g08560	intergenic_region ; MODIFIER	silent_mutation	Average:36.909; most accessible tissue: Zhenshan97 flag leaf, score: 71.63	N	N	N	N
vg1004652594	A -> DEL	N	N	silent_mutation	Average:36.909; most accessible tissue: Zhenshan97 flag leaf, score: 71.63	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1004652594	NA	1.74E-06	mr1471	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004652594	NA	4.92E-07	mr1808	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004652594	NA	2.86E-06	mr1830	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004652594	NA	5.43E-06	mr1308_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004652594	1.34E-06	NA	mr1723_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004652594	NA	1.19E-06	mr1723_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004652594	NA	1.17E-12	mr1853_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004652594	8.18E-06	8.18E-06	mr1853_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251