Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1004639213:

Variant ID: vg1004639213 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 4639213
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.75, A: 0.27, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:

TCACCGTCTCTCTCTCCCTTCGCCCGTCATCGCCGGATCTGGTAGGTCACGCCTCCTACTCCCCACCGTGCTACCGCCAACTCCGCCCCAACACGCCGCT[G/A]
AGGGTGAAAGGGGAAACTACCACTGCGAGAGCGGGACCACAAGCGCAAGGCTTCGCCACATCATCACCCAACGCGAAGCCCCAAGCTGTGGCTTGACGAA

Reverse complement sequence

TTCGTCAAGCCACAGCTTGGGGCTTCGCGTTGGGTGATGATGTGGCGAAGCCTTGCGCTTGTGGTCCCGCTCTCGCAGTGGTAGTTTCCCCTTTCACCCT[C/T]
AGCGGCGTGTTGGGGCGGAGTTGGCGGTAGCACGGTGGGGAGTAGGAGGCGTGACCTACCAGATCCGGCGATGACGGGCGAAGGGAGAGAGAGACGGTGA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	78.70%	21.20%	0.15%	0.00%	NA
All Indica	2759	93.60%	6.30%	0.07%	0.00%	NA
All Japonica	1512	49.90%	49.90%	0.20%	0.00%	NA
Aus	269	99.30%	0.70%	0.00%	0.00%	NA
Indica I	595	99.30%	0.70%	0.00%	0.00%	NA
Indica II	465	87.70%	12.00%	0.22%	0.00%	NA
Indica III	913	91.60%	8.30%	0.11%	0.00%	NA
Indica Intermediate	786	95.00%	5.00%	0.00%	0.00%	NA
Temperate Japonica	767	66.20%	33.60%	0.13%	0.00%	NA
Tropical Japonica	504	27.80%	71.80%	0.40%	0.00%	NA
Japonica Intermediate	241	44.00%	56.00%	0.00%	0.00%	NA
VI/Aromatic	96	43.80%	55.20%	1.04%	0.00%	NA
Intermediate	90	80.00%	18.90%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1004639213	G -> A	LOC_Os10g08540.1	downstream_gene_variant ; 3062.0bp to feature; MODIFIER	silent_mutation	Average:94.093; most accessible tissue: Callus, score: 98.231	N	N	N	N
vg1004639213	G -> A	LOC_Os10g08550.1	downstream_gene_variant ; 478.0bp to feature; MODIFIER	silent_mutation	Average:94.093; most accessible tissue: Callus, score: 98.231	N	N	N	N
vg1004639213	G -> A	LOC_Os10g08550.5	downstream_gene_variant ; 478.0bp to feature; MODIFIER	silent_mutation	Average:94.093; most accessible tissue: Callus, score: 98.231	N	N	N	N
vg1004639213	G -> A	LOC_Os10g08550.3	downstream_gene_variant ; 480.0bp to feature; MODIFIER	silent_mutation	Average:94.093; most accessible tissue: Callus, score: 98.231	N	N	N	N
vg1004639213	G -> A	LOC_Os10g08540-LOC_Os10g08550	intergenic_region ; MODIFIER	silent_mutation	Average:94.093; most accessible tissue: Callus, score: 98.231	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg1004639213	G	A	0.0	-0.01	-0.01	0.01	0.0	0.0

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1004639213	NA	9.90E-18	mr1118	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004639213	NA	1.84E-06	mr1420	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004639213	NA	9.84E-07	mr1489	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004639213	NA	4.64E-07	mr1797	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004639213	NA	4.64E-07	mr1801	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004639213	NA	1.67E-06	mr1113_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004639213	NA	7.69E-06	mr1114_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004639213	5.92E-06	NA	mr1563_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004639213	NA	9.85E-09	mr1709_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004639213	NA	4.48E-06	mr1768_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251