Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1004627303:

Variant ID: vg1004627303 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 4627303
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:

TTTTAGAAAATTCTCTAATTTATTATAGTGCCACGTGGCGGTGTAGGAACATTTGTAGGATGACACGTGGCGACTTAGGAGCGTTTGTAGGAAATATAAT[G/A]
GACTTTTAGTATATAATAGATAATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATGATAGATAGAGAAACATGTTAATTACATGAGC

Reverse complement sequence

GCTCATGTAATTAACATGTTTCTCTATCTATCATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATTATCTATTATATACTAAAAGTC[C/T]
ATTATATTTCCTACAAACGCTCCTAAGTCGCCACGTGTCATCCTACAAATGTTCCTACACCGCCACGTGGCACTATAATAAATTAGAGAATTTTCTAAAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	54.40%	28.00%	2.03%	15.51%	NA
All Indica	2759	35.80%	39.90%	2.03%	22.29%	NA
All Japonica	1512	86.80%	11.80%	0.07%	1.26%	NA
Aus	269	65.10%	4.10%	3.72%	27.14%	NA
Indica I	595	31.60%	40.20%	1.85%	26.39%	NA
Indica II	465	44.10%	35.70%	2.37%	17.85%	NA
Indica III	913	38.70%	46.40%	1.86%	13.03%	NA
Indica Intermediate	786	30.70%	34.60%	2.16%	32.57%	NA
Temperate Japonica	767	93.50%	6.00%	0.00%	0.52%	NA
Tropical Japonica	504	86.10%	12.50%	0.00%	1.39%	NA
Japonica Intermediate	241	67.20%	29.00%	0.41%	3.32%	NA
VI/Aromatic	96	52.10%	14.60%	23.96%	9.38%	NA
Intermediate	90	52.20%	22.20%	6.67%	18.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1004627303	G -> A	LOC_Os10g08540.1	upstream_gene_variant ; 1990.0bp to feature; MODIFIER	silent_mutation	Average:52.199; most accessible tissue: Minghui63 root, score: 88.953	N	N	N	N
vg1004627303	G -> A	LOC_Os10g08530.1	intron_variant ; MODIFIER	silent_mutation	Average:52.199; most accessible tissue: Minghui63 root, score: 88.953	N	N	N	N
vg1004627303	G -> DEL	N	N	silent_mutation	Average:52.199; most accessible tissue: Minghui63 root, score: 88.953	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1004627303	NA	7.49E-06	mr1032	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004627303	NA	1.30E-06	mr1053_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004627303	4.85E-06	NA	mr1327_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004627303	3.36E-06	NA	mr1723_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004627303	NA	4.90E-06	mr1729_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004627303	NA	3.43E-07	mr1800_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251