Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1004625214:

Variant ID: vg1004625214 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 4625214
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.58, A: 0.42, others allele: 0.00, population size: 88. )

Flanking Sequence (100 bp) in Reference Genome:

CTACTCTATTCCTATTCCACTAGCTTGATACTACTAAACTAAACTTGAGAGAATATGAGAGAGCTTGCTTGAGGTGTGTGAGTGAAGTGAGAAGGTGAGG[A/G]
GTTTATCTAGCCTCCCAATGACGGTTGTAACGGTTGGAATAGTCGGAAATACCCTCCAACCGTCATTGGGAGCTAATCCACACCGTCCAGAAGAAGCCCT

Reverse complement sequence

AGGGCTTCTTCTGGACGGTGTGGATTAGCTCCCAATGACGGTTGGAGGGTATTTCCGACTATTCCAACCGTTACAACCGTCATTGGGAGGCTAGATAAAC[T/C]
CCTCACCTTCTCACTTCACTCACACACCTCAAGCAAGCTCTCTCATATTCTCTCAAGTTTAGTTTAGTAGTATCAAGCTAGTGGAATAGGAATAGAGTAG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	41.80%	18.20%	0.28%	39.80%	NA
All Indica	2759	42.80%	1.20%	0.43%	55.56%	NA
All Japonica	1512	45.60%	52.60%	0.00%	1.79%	NA
Aus	269	5.20%	0.70%	0.37%	93.68%	NA
Indica I	595	41.00%	1.20%	0.67%	57.14%	NA
Indica II	465	38.10%	1.30%	0.43%	60.22%	NA
Indica III	913	49.70%	0.80%	0.33%	49.18%	NA
Indica Intermediate	786	39.10%	1.50%	0.38%	59.03%	NA
Temperate Japonica	767	11.70%	87.60%	0.00%	0.65%	NA
Tropical Japonica	504	93.30%	4.80%	0.00%	1.98%	NA
Japonica Intermediate	241	53.90%	41.10%	0.00%	4.98%	NA
VI/Aromatic	96	43.80%	14.60%	0.00%	41.67%	NA
Intermediate	90	51.10%	16.70%	0.00%	32.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1004625214	A -> G	LOC_Os10g08520.1	upstream_gene_variant ; 4423.0bp to feature; MODIFIER	silent_mutation	Average:34.283; most accessible tissue: Minghui63 young leaf, score: 61.007	N	N	N	N
vg1004625214	A -> G	LOC_Os10g08530.1	upstream_gene_variant ; 18.0bp to feature; MODIFIER	silent_mutation	Average:34.283; most accessible tissue: Minghui63 young leaf, score: 61.007	N	N	N	N
vg1004625214	A -> G	LOC_Os10g08540.1	upstream_gene_variant ; 4079.0bp to feature; MODIFIER	silent_mutation	Average:34.283; most accessible tissue: Minghui63 young leaf, score: 61.007	N	N	N	N
vg1004625214	A -> G	LOC_Os10g08520-LOC_Os10g08530	intergenic_region ; MODIFIER	silent_mutation	Average:34.283; most accessible tissue: Minghui63 young leaf, score: 61.007	N	N	N	N
vg1004625214	A -> DEL	N	N	silent_mutation	Average:34.283; most accessible tissue: Minghui63 young leaf, score: 61.007	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1004625214	NA	5.71E-06	mr1006	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004625214	NA	7.75E-06	mr1032	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004625214	NA	7.24E-06	mr1047	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004625214	NA	1.36E-06	mr1118	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004625214	NA	4.70E-06	mr1300	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004625214	NA	6.64E-08	mr1310	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004625214	NA	3.17E-06	mr1471	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004625214	NA	6.06E-11	mr1580	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004625214	NA	1.10E-07	mr1603	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004625214	NA	6.07E-09	mr1679	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004625214	NA	5.38E-09	mr1825	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004625214	NA	1.56E-06	mr1870	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004625214	NA	1.24E-07	mr1926	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004625214	NA	4.26E-06	mr1040_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004625214	NA	2.23E-06	mr1206_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004625214	NA	7.61E-07	mr1220_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004625214	NA	7.42E-07	mr1250_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004625214	NA	3.07E-06	mr1263_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004625214	NA	3.28E-06	mr1308_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004625214	NA	4.85E-08	mr1310_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004625214	NA	3.00E-06	mr1318_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004625214	7.48E-06	NA	mr1404_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004625214	NA	7.87E-06	mr1567_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004625214	NA	6.33E-06	mr1596_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004625214	NA	6.97E-08	mr1603_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004625214	NA	7.37E-06	mr1711_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004625214	NA	4.69E-06	mr1723_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004625214	NA	2.42E-06	mr1729_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004625214	NA	3.72E-06	mr1763_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004625214	NA	5.45E-06	mr1771_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004625214	NA	6.59E-07	mr1784_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004625214	NA	4.52E-07	mr1800_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004625214	NA	9.88E-06	mr1915_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004625214	6.33E-06	8.74E-06	mr1930_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004625214	NA	3.07E-06	mr1959_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251