\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1004625214:

Variant ID: vg1004625214 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 4625214
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.58, A: 0.42, others allele: 0.00, population size: 88. )

Flanking Sequence (100 bp) in Reference Genome:


CTACTCTATTCCTATTCCACTAGCTTGATACTACTAAACTAAACTTGAGAGAATATGAGAGAGCTTGCTTGAGGTGTGTGAGTGAAGTGAGAAGGTGAGG[A/G]
GTTTATCTAGCCTCCCAATGACGGTTGTAACGGTTGGAATAGTCGGAAATACCCTCCAACCGTCATTGGGAGCTAATCCACACCGTCCAGAAGAAGCCCT

Reverse complement sequence

AGGGCTTCTTCTGGACGGTGTGGATTAGCTCCCAATGACGGTTGGAGGGTATTTCCGACTATTCCAACCGTTACAACCGTCATTGGGAGGCTAGATAAAC[T/C]
CCTCACCTTCTCACTTCACTCACACACCTCAAGCAAGCTCTCTCATATTCTCTCAAGTTTAGTTTAGTAGTATCAAGCTAGTGGAATAGGAATAGAGTAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 41.80% 18.20% 0.28% 39.80% NA
All Indica  2759 42.80% 1.20% 0.43% 55.56% NA
All Japonica  1512 45.60% 52.60% 0.00% 1.79% NA
Aus  269 5.20% 0.70% 0.37% 93.68% NA
Indica I  595 41.00% 1.20% 0.67% 57.14% NA
Indica II  465 38.10% 1.30% 0.43% 60.22% NA
Indica III  913 49.70% 0.80% 0.33% 49.18% NA
Indica Intermediate  786 39.10% 1.50% 0.38% 59.03% NA
Temperate Japonica  767 11.70% 87.60% 0.00% 0.65% NA
Tropical Japonica  504 93.30% 4.80% 0.00% 1.98% NA
Japonica Intermediate  241 53.90% 41.10% 0.00% 4.98% NA
VI/Aromatic  96 43.80% 14.60% 0.00% 41.67% NA
Intermediate  90 51.10% 16.70% 0.00% 32.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1004625214 A -> G LOC_Os10g08520.1 upstream_gene_variant ; 4423.0bp to feature; MODIFIER silent_mutation Average:34.283; most accessible tissue: Minghui63 young leaf, score: 61.007 N N N N
vg1004625214 A -> G LOC_Os10g08530.1 upstream_gene_variant ; 18.0bp to feature; MODIFIER silent_mutation Average:34.283; most accessible tissue: Minghui63 young leaf, score: 61.007 N N N N
vg1004625214 A -> G LOC_Os10g08540.1 upstream_gene_variant ; 4079.0bp to feature; MODIFIER silent_mutation Average:34.283; most accessible tissue: Minghui63 young leaf, score: 61.007 N N N N
vg1004625214 A -> G LOC_Os10g08520-LOC_Os10g08530 intergenic_region ; MODIFIER silent_mutation Average:34.283; most accessible tissue: Minghui63 young leaf, score: 61.007 N N N N
vg1004625214 A -> DEL N N silent_mutation Average:34.283; most accessible tissue: Minghui63 young leaf, score: 61.007 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1004625214 NA 5.71E-06 mr1006 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004625214 NA 7.75E-06 mr1032 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004625214 NA 7.24E-06 mr1047 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004625214 NA 1.36E-06 mr1118 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004625214 NA 4.70E-06 mr1300 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004625214 NA 6.64E-08 mr1310 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004625214 NA 3.17E-06 mr1471 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004625214 NA 6.06E-11 mr1580 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004625214 NA 1.10E-07 mr1603 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004625214 NA 6.07E-09 mr1679 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004625214 NA 5.38E-09 mr1825 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004625214 NA 1.56E-06 mr1870 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004625214 NA 1.24E-07 mr1926 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004625214 NA 4.26E-06 mr1040_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004625214 NA 2.23E-06 mr1206_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004625214 NA 7.61E-07 mr1220_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004625214 NA 7.42E-07 mr1250_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004625214 NA 3.07E-06 mr1263_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004625214 NA 3.28E-06 mr1308_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004625214 NA 4.85E-08 mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004625214 NA 3.00E-06 mr1318_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004625214 7.48E-06 NA mr1404_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004625214 NA 7.87E-06 mr1567_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004625214 NA 6.33E-06 mr1596_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004625214 NA 6.97E-08 mr1603_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004625214 NA 7.37E-06 mr1711_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004625214 NA 4.69E-06 mr1723_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004625214 NA 2.42E-06 mr1729_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004625214 NA 3.72E-06 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004625214 NA 5.45E-06 mr1771_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004625214 NA 6.59E-07 mr1784_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004625214 NA 4.52E-07 mr1800_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004625214 NA 9.88E-06 mr1915_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004625214 6.33E-06 8.74E-06 mr1930_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004625214 NA 3.07E-06 mr1959_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251