Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1004624542:

Variant ID: vg1004624542 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 4624542
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACTTCACTCACACACCTCAAGCAAGAGCTATCTCATTCCTCTCAAGTTTAGTTTAGTAGTATCTAGCTAGTGGAATAGAATTAGAGTAGGAATCAGGAGT[T/C]
CGGAAGCCTTCGGAAGAGTTCGGGTATGGCTCTAGTAGCAATTACTCTATGGCAAGGGTAGAGTGACACACAAGCATTACTACTCATCCTCATAATATAT

Reverse complement sequence

ATATATTATGAGGATGAGTAGTAATGCTTGTGTGTCACTCTACCCTTGCCATAGAGTAATTGCTACTAGAGCCATACCCGAACTCTTCCGAAGGCTTCCG[A/G]
ACTCCTGATTCCTACTCTAATTCTATTCCACTAGCTAGATACTACTAAACTAAACTTGAGAGGAATGAGATAGCTCTTGCTTGAGGTGTGTGAGTGAAGT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	50.40%	9.80%	1.23%	38.55%	NA
All Indica	2759	43.80%	0.70%	1.85%	53.68%	NA
All Japonica	1512	72.00%	26.30%	0.07%	1.72%	NA
Aus	269	6.30%	0.00%	1.86%	91.82%	NA
Indica I	595	42.00%	0.00%	1.51%	56.47%	NA
Indica II	465	39.80%	0.20%	2.15%	57.85%	NA
Indica III	913	50.80%	0.40%	1.64%	47.10%	NA
Indica Intermediate	786	39.40%	1.70%	2.16%	56.74%	NA
Temperate Japonica	767	94.00%	5.30%	0.00%	0.65%	NA
Tropical Japonica	504	37.90%	60.10%	0.00%	1.98%	NA
Japonica Intermediate	241	73.00%	22.00%	0.41%	4.56%	NA
VI/Aromatic	96	29.20%	29.20%	0.00%	41.67%	NA
Intermediate	90	45.60%	22.20%	1.11%	31.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1004624542	T -> C	LOC_Os10g08520.1	upstream_gene_variant ; 3751.0bp to feature; MODIFIER	silent_mutation	Average:30.149; most accessible tissue: Minghui63 young leaf, score: 73.49	N	N	N	N
vg1004624542	T -> C	LOC_Os10g08530.1	upstream_gene_variant ; 690.0bp to feature; MODIFIER	silent_mutation	Average:30.149; most accessible tissue: Minghui63 young leaf, score: 73.49	N	N	N	N
vg1004624542	T -> C	LOC_Os10g08540.1	upstream_gene_variant ; 4751.0bp to feature; MODIFIER	silent_mutation	Average:30.149; most accessible tissue: Minghui63 young leaf, score: 73.49	N	N	N	N
vg1004624542	T -> C	LOC_Os10g08520-LOC_Os10g08530	intergenic_region ; MODIFIER	silent_mutation	Average:30.149; most accessible tissue: Minghui63 young leaf, score: 73.49	N	N	N	N
vg1004624542	T -> DEL	N	N	silent_mutation	Average:30.149; most accessible tissue: Minghui63 young leaf, score: 73.49	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1004624542	1.44E-06	NA	mr1020	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004624542	1.60E-07	NA	mr1021	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004624542	NA	6.19E-06	mr1029	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004624542	NA	4.32E-08	mr1471	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004624542	3.38E-08	NA	mr1477	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004624542	NA	4.88E-11	mr1553	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004624542	NA	5.93E-09	mr1642	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004624542	NA	9.41E-07	mr1642	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004624542	NA	4.44E-06	mr1725	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004624542	NA	4.81E-07	mr1797	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004624542	NA	4.81E-07	mr1801	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004624542	3.13E-06	NA	mr1971	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004624542	NA	1.81E-09	mr1398_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004624542	NA	7.20E-06	mr1553_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004624542	NA	4.20E-08	mr1817_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251