\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1004623296:

Variant ID: vg1004623296 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 4623296
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, C: 0.03, A: 0.01, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:


TTCTGCCTGTAAACTGCAAGACGAATTTATTAAGCCTAATTAATTCGTCGTTAGCAAATGTTTACTGTAGCATCACATTCTTAAATCATGGCGCAATTAG[G/A]
CTTGAAAGATTCATCTCGCAATTTACATGCAAATTGTACAATTGGTTTTTTTTGTCCACATTTAATGATCCATGCACATGTGTCCAAACATTTGATGTAA

Reverse complement sequence

TTACATCAAATGTTTGGACACATGTGCATGGATCATTAAATGTGGACAAAAAAAACCAATTGTACAATTTGCATGTAAATTGCGAGATGAATCTTTCAAG[C/T]
CTAATTGCGCCATGATTTAAGAATGTGATGCTACAGTAAACATTTGCTAACGACGAATTAATTAGGCTTAATAAATTCGTCTTGCAGTTTACAGGCAGAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 31.80% 28.10% 9.12% 30.98% NA
All Indica  2759 41.80% 2.50% 10.37% 45.31% NA
All Japonica  1512 19.70% 77.80% 0.93% 1.52% NA
Aus  269 4.50% 1.50% 38.29% 55.76% NA
Indica I  595 40.70% 2.20% 4.54% 52.61% NA
Indica II  465 37.60% 2.40% 5.38% 54.62% NA
Indica III  913 49.30% 1.50% 19.06% 30.12% NA
Indica Intermediate  786 36.50% 3.90% 7.63% 51.91% NA
Temperate Japonica  767 7.60% 90.50% 1.30% 0.65% NA
Tropical Japonica  504 32.90% 65.10% 0.00% 1.98% NA
Japonica Intermediate  241 30.70% 64.30% 1.66% 3.32% NA
VI/Aromatic  96 14.60% 43.80% 23.96% 17.71% NA
Intermediate  90 28.90% 38.90% 5.56% 26.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1004623296 G -> A LOC_Os10g08520.1 upstream_gene_variant ; 2505.0bp to feature; MODIFIER silent_mutation Average:21.57; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N
vg1004623296 G -> A LOC_Os10g08530.1 upstream_gene_variant ; 1936.0bp to feature; MODIFIER silent_mutation Average:21.57; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N
vg1004623296 G -> A LOC_Os10g08520-LOC_Os10g08530 intergenic_region ; MODIFIER silent_mutation Average:21.57; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N
vg1004623296 G -> DEL N N silent_mutation Average:21.57; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1004623296 1.95E-06 NA mr1020 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004623296 1.90E-07 1.48E-13 mr1032 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004623296 NA 3.39E-06 mr1032 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004623296 9.08E-07 NA mr1165 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004623296 9.75E-07 NA mr1478 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004623296 1.63E-06 3.58E-06 mr1708 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004623296 1.03E-06 NA mr1971 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004623296 NA 2.25E-06 mr1053_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004623296 2.87E-06 NA mr1165_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004623296 NA 7.91E-06 mr1165_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004623296 4.02E-06 NA mr1327_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004623296 NA 1.11E-06 mr1800_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251