Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1004623296:

Variant ID: vg1004623296 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 4623296
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, C: 0.03, A: 0.01, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:

TTCTGCCTGTAAACTGCAAGACGAATTTATTAAGCCTAATTAATTCGTCGTTAGCAAATGTTTACTGTAGCATCACATTCTTAAATCATGGCGCAATTAG[G/A]
CTTGAAAGATTCATCTCGCAATTTACATGCAAATTGTACAATTGGTTTTTTTTGTCCACATTTAATGATCCATGCACATGTGTCCAAACATTTGATGTAA

Reverse complement sequence

TTACATCAAATGTTTGGACACATGTGCATGGATCATTAAATGTGGACAAAAAAAACCAATTGTACAATTTGCATGTAAATTGCGAGATGAATCTTTCAAG[C/T]
CTAATTGCGCCATGATTTAAGAATGTGATGCTACAGTAAACATTTGCTAACGACGAATTAATTAGGCTTAATAAATTCGTCTTGCAGTTTACAGGCAGAA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	31.80%	28.10%	9.12%	30.98%	NA
All Indica	2759	41.80%	2.50%	10.37%	45.31%	NA
All Japonica	1512	19.70%	77.80%	0.93%	1.52%	NA
Aus	269	4.50%	1.50%	38.29%	55.76%	NA
Indica I	595	40.70%	2.20%	4.54%	52.61%	NA
Indica II	465	37.60%	2.40%	5.38%	54.62%	NA
Indica III	913	49.30%	1.50%	19.06%	30.12%	NA
Indica Intermediate	786	36.50%	3.90%	7.63%	51.91%	NA
Temperate Japonica	767	7.60%	90.50%	1.30%	0.65%	NA
Tropical Japonica	504	32.90%	65.10%	0.00%	1.98%	NA
Japonica Intermediate	241	30.70%	64.30%	1.66%	3.32%	NA
VI/Aromatic	96	14.60%	43.80%	23.96%	17.71%	NA
Intermediate	90	28.90%	38.90%	5.56%	26.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1004623296	G -> A	LOC_Os10g08520.1	upstream_gene_variant ; 2505.0bp to feature; MODIFIER	silent_mutation	Average:21.57; most accessible tissue: Minghui63 panicle, score: 29.741	N	N	N	N
vg1004623296	G -> A	LOC_Os10g08530.1	upstream_gene_variant ; 1936.0bp to feature; MODIFIER	silent_mutation	Average:21.57; most accessible tissue: Minghui63 panicle, score: 29.741	N	N	N	N
vg1004623296	G -> A	LOC_Os10g08520-LOC_Os10g08530	intergenic_region ; MODIFIER	silent_mutation	Average:21.57; most accessible tissue: Minghui63 panicle, score: 29.741	N	N	N	N
vg1004623296	G -> DEL	N	N	silent_mutation	Average:21.57; most accessible tissue: Minghui63 panicle, score: 29.741	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1004623296	1.95E-06	NA	mr1020	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004623296	1.90E-07	1.48E-13	mr1032	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004623296	NA	3.39E-06	mr1032	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004623296	9.08E-07	NA	mr1165	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004623296	9.75E-07	NA	mr1478	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004623296	1.63E-06	3.58E-06	mr1708	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004623296	1.03E-06	NA	mr1971	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004623296	NA	2.25E-06	mr1053_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004623296	2.87E-06	NA	mr1165_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004623296	NA	7.91E-06	mr1165_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004623296	4.02E-06	NA	mr1327_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004623296	NA	1.11E-06	mr1800_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251