\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1004618983:

Variant ID: vg1004618983 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 4618983
Reference Allele: TAlternative Allele: G
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTTTGGTGCGGGTATAGTGTTTGCTTATGCAATTACTCTATGTCATGACGATGATATTAGAGTAGTACCTAGTAGTTTAGACGTGGTGTCTAGATTACGA[T/G]
ATATCATTATTTGGGGTTATATATTGCGGATGAGAGGTGGGCCGCTGATGGTGACAGCTCAATACGGGTATTCCTCCGCGCCTATATATAATCCTAAGTT

Reverse complement sequence

AACTTAGGATTATATATAGGCGCGGAGGAATACCCGTATTGAGCTGTCACCATCAGCGGCCCACCTCTCATCCGCAATATATAACCCCAAATAATGATAT[A/C]
TCGTAATCTAGACACCACGTCTAAACTACTAGGTACTACTCTAATATCATCGTCATGACATAGAGTAATTGCATAAGCAAACACTATACCCGCACCAAAG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.10% 11.40% 6.24% 33.26% NA
All Indica  2759 44.10% 0.80% 8.74% 46.39% NA
All Japonica  1512 67.10% 31.10% 0.07% 1.72% NA
Aus  269 6.70% 0.70% 17.47% 75.09% NA
Indica I  595 42.70% 0.20% 8.57% 48.57% NA
Indica II  465 39.60% 0.20% 10.11% 50.11% NA
Indica III  913 51.30% 0.40% 7.56% 40.74% NA
Indica Intermediate  786 39.60% 1.90% 9.41% 49.11% NA
Temperate Japonica  767 84.60% 14.70% 0.13% 0.52% NA
Tropical Japonica  504 37.90% 60.10% 0.00% 1.98% NA
Japonica Intermediate  241 72.60% 22.40% 0.00% 4.98% NA
VI/Aromatic  96 29.20% 29.20% 4.17% 37.50% NA
Intermediate  90 45.60% 21.10% 2.22% 31.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1004618983 T -> G LOC_Os10g08510.1 upstream_gene_variant ; 4037.0bp to feature; MODIFIER silent_mutation Average:39.119; most accessible tissue: Minghui63 young leaf, score: 71.839 N N N N
vg1004618983 T -> G LOC_Os10g08520.1 downstream_gene_variant ; 1248.0bp to feature; MODIFIER silent_mutation Average:39.119; most accessible tissue: Minghui63 young leaf, score: 71.839 N N N N
vg1004618983 T -> G LOC_Os10g08510-LOC_Os10g08520 intergenic_region ; MODIFIER silent_mutation Average:39.119; most accessible tissue: Minghui63 young leaf, score: 71.839 N N N N
vg1004618983 T -> DEL N N silent_mutation Average:39.119; most accessible tissue: Minghui63 young leaf, score: 71.839 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1004618983 7.61E-09 NA mr1020 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004618983 NA 3.16E-06 mr1020 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004618983 1.27E-07 NA mr1032 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004618983 NA 1.69E-06 mr1032 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004618983 6.30E-06 NA mr1165 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004618983 NA 1.01E-10 mr1471 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004618983 NA 2.39E-07 mr1471 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004618983 2.77E-06 NA mr1477 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004618983 3.49E-06 NA mr1478 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004618983 NA 5.64E-07 mr1642 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004618983 NA 7.08E-06 mr1708 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004618983 NA 6.31E-06 mr1725 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004618983 NA 8.26E-08 mr1808 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004618983 NA 1.32E-06 mr1817 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004618983 1.08E-06 4.38E-13 mr1853 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004618983 NA 5.38E-06 mr1892 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004618983 5.91E-08 NA mr1971 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004618983 1.20E-06 NA mr1165_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004618983 NA 4.42E-06 mr1165_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004618983 8.13E-06 NA mr1305_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004618983 1.47E-06 NA mr1327_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004618983 NA 4.48E-08 mr1379_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004618983 NA 4.25E-07 mr1401_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004618983 NA 4.48E-07 mr1415_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004618983 3.35E-06 NA mr1477_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004618983 NA 1.21E-08 mr1559_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004618983 NA 5.72E-07 mr1606_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004618983 NA 1.53E-07 mr1765_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004618983 NA 7.03E-08 mr1817_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004618983 2.55E-06 3.71E-12 mr1853_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251