Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1004618887:

Variant ID: vg1004618887 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 4618887
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.02, others allele: 0.00, population size: 204. )

Flanking Sequence (100 bp) in Reference Genome:

CATTTATGGTATTGAAATACTTTCCGAGTATATGAGTACCTACTTTACATTACGTTCATGTTATACTGAATATACGGCTAGCTTATCTGGGAGATGCTTT[G/A]
GTGCGGGTATAGTGTTTGCTTATGCAATTACTCTATGTCATGACGATGATATTAGAGTAGTACCTAGTAGTTTAGACGTGGTGTCTAGATTACGATATAT

Reverse complement sequence

ATATATCGTAATCTAGACACCACGTCTAAACTACTAGGTACTACTCTAATATCATCGTCATGACATAGAGTAATTGCATAAGCAAACACTATACCCGCAC[C/T]
AAAGCATCTCCCAGATAAGCTAGCCGTATATTCAGTATAACATGAACGTAATGTAAAGTAGGTACTCATATACTCGGAAAGTATTTCAATACCATAAATG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	52.40%	31.30%	9.18%	7.07%	NA
All Indica	2759	35.40%	41.50%	13.52%	9.57%	NA
All Japonica	1512	80.20%	19.00%	0.40%	0.46%	NA
Aus	269	62.50%	4.10%	14.87%	18.59%	NA
Indica I	595	36.80%	40.50%	13.11%	9.58%	NA
Indica II	465	41.10%	37.20%	15.91%	5.81%	NA
Indica III	913	30.60%	49.20%	9.64%	10.62%	NA
Indica Intermediate	786	36.60%	35.90%	16.92%	10.56%	NA
Temperate Japonica	767	93.90%	6.10%	0.00%	0.00%	NA
Tropical Japonica	504	65.90%	32.90%	0.60%	0.60%	NA
Japonica Intermediate	241	66.40%	30.70%	1.24%	1.66%	NA
VI/Aromatic	96	68.80%	14.60%	9.38%	7.29%	NA
Intermediate	90	60.00%	26.70%	6.67%	6.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1004618887	G -> A	LOC_Os10g08510.1	upstream_gene_variant ; 3941.0bp to feature; MODIFIER	silent_mutation	Average:44.811; most accessible tissue: Zhenshan97 panicle, score: 72.468	N	N	N	N
vg1004618887	G -> A	LOC_Os10g08520.1	downstream_gene_variant ; 1344.0bp to feature; MODIFIER	silent_mutation	Average:44.811; most accessible tissue: Zhenshan97 panicle, score: 72.468	N	N	N	N
vg1004618887	G -> A	LOC_Os10g08510-LOC_Os10g08520	intergenic_region ; MODIFIER	silent_mutation	Average:44.811; most accessible tissue: Zhenshan97 panicle, score: 72.468	N	N	N	N
vg1004618887	G -> DEL	N	N	silent_mutation	Average:44.811; most accessible tissue: Zhenshan97 panicle, score: 72.468	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1004618887	8.66E-06	NA	mr1020	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004618887	2.43E-06	NA	mr1032	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004618887	NA	3.60E-06	mr1032	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004618887	1.81E-07	2.72E-07	mr1708	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004618887	7.72E-07	NA	mr1327_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004618887	3.47E-06	NA	mr1327_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004618887	NA	3.79E-07	mr1800_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251