Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1004612584:

Variant ID: vg1004612584 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 4612584
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTGGGGAGAGCGAGGAGGAGTGCAGTGGGTTCGGGCGAAATGGGGGAAACGAGAGAGGATGCTCCGGGGATCGTTTATATACACTCGTGGAGGGGGAATC[G/A]
TGGCCGAGTGGGGCGGCAACGGCCAGTGAAGTGGCGAGGCATCGTGGGATCGTGGGGGCCAAATCGGCGCCGGTTTTTGGGGAAAAACGAGGGAGGAGGT

Reverse complement sequence

ACCTCCTCCCTCGTTTTTCCCCAAAAACCGGCGCCGATTTGGCCCCCACGATCCCACGATGCCTCGCCACTTCACTGGCCGTTGCCGCCCCACTCGGCCA[C/T]
GATTCCCCCTCCACGAGTGTATATAAACGATCCCCGGAGCATCCTCTCTCGTTTCCCCCATTTCGCCCGAACCCACTGCACTCCTCCTCGCTCTCCCCAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.30% 2.00% 0.70% 0.00% NA
All Indica  2759 99.60% 0.30% 0.11% 0.00% NA
All Japonica  1512 94.40% 4.40% 1.26% 0.00% NA
Aus  269 95.90% 1.10% 2.97% 0.00% NA
Indica I  595 99.20% 0.50% 0.34% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.50% 0.50% 0.00% 0.00% NA
Indica Intermediate  786 99.70% 0.10% 0.13% 0.00% NA
Temperate Japonica  767 91.50% 8.20% 0.26% 0.00% NA
Tropical Japonica  504 96.80% 0.00% 3.17% 0.00% NA
Japonica Intermediate  241 98.30% 1.20% 0.41% 0.00% NA
VI/Aromatic  96 81.20% 15.60% 3.12% 0.00% NA
Intermediate  90 100.00% 0.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1004612584 G -> A LOC_Os10g08500.1 synonymous_variant ; p.Ser94Ser; LOW synonymous_codon Average:67.173; most accessible tissue: Zhenshan97 flag leaf, score: 83.994 N N N N
vg1004612584 G -> A LOC_Os10g08500.1 synonymous_variant ; p.Ser94Ser; LOW nonsynonymous_codon ; S94P Average:67.173; most accessible tissue: Zhenshan97 flag leaf, score: 83.994 unknown unknown TOLERATED 0.15

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1004612584 G A 0.0 0.0 0.0 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1004612584 4.42E-06 NA mr1069 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004612584 6.66E-08 6.66E-08 mr1200 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004612584 4.30E-06 4.30E-06 mr1855 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251