\
| Variant ID: vg1004591319 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 4591319 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 213. )
AAATTTCTAATCATATCTTATTTGTAGAAAGTTTTCTGAAGAGAAGCATGCAATGCATAATAATCTTTCAGTCGAGGGGCTTGATCAATTGATGAGAGAG[G/A]
AATTTGTTGACTGGTTTAAGAATGCTGTAAAAACTCTATATATATCCTTATATTTTCTTACCTATAATGTTCAAAATATATATTTTTAATTTCTAAATTA
TAATTTAGAAATTAAAAATATATATTTTGAACATTATAGGTAAGAAAATATAAGGATATATATAGAGTTTTTACAGCATTCTTAAACCAGTCAACAAATT[C/T]
CTCTCTCATCAATTGATCAAGCCCCTCGACTGAAAGATTATTATGCATTGCATGCTTCTCTTCAGAAAACTTTCTACAAATAAGATATGATTAGAAATTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.40% | 5.40% | 2.14% | 3.09% | NA |
| All Indica | 2759 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 70.60% | 14.10% | 6.28% | 9.06% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 86.40% | 5.20% | 8.34% | 0.00% | NA |
| Tropical Japonica | 504 | 42.50% | 26.00% | 5.95% | 25.60% | NA |
| Japonica Intermediate | 241 | 78.80% | 17.40% | 0.41% | 3.32% | NA |
| VI/Aromatic | 96 | 75.00% | 13.50% | 5.21% | 6.25% | NA |
| Intermediate | 90 | 85.60% | 10.00% | 1.11% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1004591319 | G -> A | LOC_Os10g08450.1 | missense_variant ; p.Glu756Lys; MODERATE | nonsynonymous_codon ; E756K | Average:43.741; most accessible tissue: Callus, score: 68.581 | unknown | unknown | TOLERATED | 0.59 |
| vg1004591319 | G -> DEL | LOC_Os10g08450.1 | N | frameshift_variant | Average:43.741; most accessible tissue: Callus, score: 68.581 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1004591319 | NA | 8.64E-07 | mr1420 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004591319 | NA | 2.85E-06 | mr1425 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004591319 | NA | 1.26E-07 | mr1471 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004591319 | 2.81E-06 | NA | mr1477 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004591319 | NA | 9.84E-10 | mr1642 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004591319 | NA | 2.33E-06 | mr1642 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004591319 | NA | 8.22E-06 | mr1725 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004591319 | NA | 1.10E-07 | mr1779 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004591319 | NA | 3.21E-07 | mr1797 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004591319 | NA | 3.21E-07 | mr1801 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004591319 | 4.45E-08 | NA | mr1019_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004591319 | NA | 2.99E-12 | mr1019_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004591319 | 5.81E-06 | NA | mr1055_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004591319 | NA | 5.30E-11 | mr1055_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004591319 | 1.62E-06 | NA | mr1132_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004591319 | NA | 1.92E-13 | mr1132_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004591319 | 8.19E-09 | NA | mr1261_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004591319 | NA | 4.79E-09 | mr1261_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004591319 | NA | 7.59E-06 | mr1415_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004591319 | NA | 1.81E-06 | mr1632_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |