\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1004582886:

Variant ID: vg1004582886 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 4582886
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TACTGGCGGTTTTCACATTTTTCCGCCAGCAAAAATAATAGGCCAACGCCATAAAAAATCGTTTTTCTAGTAGTGCGCGCGCCACCGCCCATCGCCGTGC[C/T]
GGCTCTACAGCTATCTCCGTCCATCCGATTCTCGCTGACGACCGACGAATGCCGTCGCGTGTCGCTAACGACTGCCATCGCCAGTCCTTCCACTCTCGCT

Reverse complement sequence

AGCGAGAGTGGAAGGACTGGCGATGGCAGTCGTTAGCGACACGCGACGGCATTCGTCGGTCGTCAGCGAGAATCGGATGGACGGAGATAGCTGTAGAGCC[G/A]
GCACGGCGATGGGCGGTGGCGCGCGCACTACTAGAAAAACGATTTTTTATGGCGTTGGCCTATTATTTTTGCTGGCGGAAAAATGTGAAAACCGCCAGTA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.30% 29.60% 0.11% 0.00% NA
All Indica  2759 94.70% 5.30% 0.04% 0.00% NA
All Japonica  1512 23.60% 76.30% 0.13% 0.00% NA
Aus  269 98.50% 1.10% 0.37% 0.00% NA
Indica I  595 99.30% 0.70% 0.00% 0.00% NA
Indica II  465 98.30% 1.70% 0.00% 0.00% NA
Indica III  913 90.50% 9.50% 0.00% 0.00% NA
Indica Intermediate  786 94.00% 5.90% 0.13% 0.00% NA
Temperate Japonica  767 8.00% 91.80% 0.26% 0.00% NA
Tropical Japonica  504 36.50% 63.50% 0.00% 0.00% NA
Japonica Intermediate  241 46.50% 53.50% 0.00% 0.00% NA
VI/Aromatic  96 35.40% 64.60% 0.00% 0.00% NA
Intermediate  90 61.10% 37.80% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1004582886 C -> T LOC_Os10g08430.1 upstream_gene_variant ; 1394.0bp to feature; MODIFIER silent_mutation Average:71.816; most accessible tissue: Zhenshan97 young leaf, score: 94.82 N N N N
vg1004582886 C -> T LOC_Os10g08440.1 downstream_gene_variant ; 1162.0bp to feature; MODIFIER silent_mutation Average:71.816; most accessible tissue: Zhenshan97 young leaf, score: 94.82 N N N N
vg1004582886 C -> T LOC_Os10g08430-LOC_Os10g08440 intergenic_region ; MODIFIER silent_mutation Average:71.816; most accessible tissue: Zhenshan97 young leaf, score: 94.82 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1004582886 C T -0.01 -0.01 -0.01 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1004582886 2.08E-06 NA mr1093 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004582886 NA 3.43E-09 mr1275 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004582886 NA 6.28E-08 mr1488 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004582886 NA 8.03E-08 mr1506 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004582886 NA 3.06E-08 mr1660 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004582886 9.98E-07 NA mr1708 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004582886 NA 2.00E-07 mr1797 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004582886 NA 2.00E-07 mr1801 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004582886 NA 2.23E-08 mr1299_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004582886 NA 6.45E-08 mr1700_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251