\
| Variant ID: vg1004573441 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 4573441 |
| Reference Allele: A | Alternative Allele: C |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.74, A: 0.26, others allele: 0.00, population size: 232. )
GACTAGTCCGATACTTTGAGGATGGGAAACGAAGCGAAGCATATTTTGACTCCCAGCCCGATGCAGTAATCCTGGAAATCGGTGCTGATGAACTGGGAGC[A/C]
GTTGTCAGTAATGATGCGATGCGGTAGTCCGTATCTGCAAAATATTCCCTTGATGAACTTGATGGCGTTGGCGGCTTTGATTTCCCCCGTGGGAACTGCT
AGCAGTTCCCACGGGGGAAATCAAAGCCGCCAACGCCATCAAGTTCATCAAGGGAATATTTTGCAGATACGGACTACCGCATCGCATCATTACTGACAAC[T/G]
GCTCCCAGTTCATCAGCACCGATTTCCAGGATTACTGCATCGGGCTGGGAGTCAAAATATGCTTCGCTTCGTTTCCCATCCTCAAAGTATCGGACTAGTC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 47.90% | 25.10% | 1.40% | 25.62% | NA |
| All Indica | 2759 | 48.40% | 21.10% | 1.45% | 29.10% | NA |
| All Japonica | 1512 | 56.70% | 17.60% | 1.59% | 24.14% | NA |
| Aus | 269 | 3.70% | 95.50% | 0.00% | 0.74% | NA |
| Indica I | 595 | 40.80% | 41.20% | 0.34% | 17.65% | NA |
| Indica II | 465 | 62.20% | 16.30% | 2.80% | 18.71% | NA |
| Indica III | 913 | 51.90% | 13.50% | 0.77% | 33.84% | NA |
| Indica Intermediate | 786 | 41.70% | 17.60% | 2.29% | 38.42% | NA |
| Temperate Japonica | 767 | 77.20% | 17.60% | 0.39% | 4.82% | NA |
| Tropical Japonica | 504 | 18.80% | 22.60% | 3.77% | 54.76% | NA |
| Japonica Intermediate | 241 | 70.50% | 7.10% | 0.83% | 21.58% | NA |
| VI/Aromatic | 96 | 16.70% | 57.30% | 0.00% | 26.04% | NA |
| Intermediate | 90 | 51.10% | 28.90% | 2.22% | 17.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1004573441 | A -> C | LOC_Os10g08420.1 | missense_variant ; p.Cys344Gly; MODERATE | nonsynonymous_codon ; C344G | Average:53.256; most accessible tissue: Zhenshan97 flag leaf, score: 77.203 | benign |
-1.198 |
TOLERATED | 1.00 |
| vg1004573441 | A -> DEL | LOC_Os10g08420.1 | N | frameshift_variant | Average:53.256; most accessible tissue: Zhenshan97 flag leaf, score: 77.203 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1004573441 | NA | 3.88E-07 | mr1808 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004573441 | 6.20E-06 | NA | mr1853 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004573441 | 3.30E-06 | NA | mr1053_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004573441 | NA | 9.06E-06 | mr1308_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004573441 | 2.46E-06 | 2.43E-06 | mr1318_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004573441 | NA | 1.27E-07 | mr1379_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004573441 | NA | 4.58E-07 | mr1401_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004573441 | NA | 4.34E-06 | mr1415_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004573441 | NA | 1.79E-08 | mr1471_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004573441 | NA | 9.52E-08 | mr1559_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004573441 | NA | 4.24E-07 | mr1606_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004573441 | NA | 2.52E-08 | mr1642_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004573441 | NA | 2.13E-07 | mr1817_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004573441 | 1.78E-06 | NA | mr1853_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004573441 | NA | 1.06E-06 | mr1888_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004573441 | 5.06E-06 | NA | mr1897_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004573441 | NA | 1.97E-13 | mr1942_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |