\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1004572532:

Variant ID: vg1004572532 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 4572532
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTCGGTTGAACAAGCACTAATCCTAGCCCCCAGCCGTGAAGTTGGAAAGTTCATTTCCGATTACGCGGCTTGGTTAATACGCATGGGGAGAACTCTTACA[C/T]
GACCAGGTCTGACATGGTCTTTCGTCTCTACAAAATCCGACAAGGCCTTATCGGCTCTGGGCGTCCCCAGCCGAAGATCCCTTAGGTTTCTCGGAGGCCT

Reverse complement sequence

AGGCCTCCGAGAAACCTAAGGGATCTTCGGCTGGGGACGCCCAGAGCCGATAAGGCCTTGTCGGATTTTGTAGAGACGAAAGACCATGTCAGACCTGGTC[G/A]
TGTAAGAGTTCTCCCCATGCGTATTAACCAAGCCGCGTAATCGGAAATGAACTTTCCAACTTCACGGCTGGGGGCTAGGATTAGTGCTTGTTCAACCGAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.40% 17.70% 0.57% 0.36% NA
All Indica  2759 68.60% 29.80% 0.94% 0.62% NA
All Japonica  1512 99.50% 0.50% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 82.40% 17.60% 0.00% 0.00% NA
Indica II  465 74.60% 20.40% 2.15% 2.80% NA
Indica III  913 64.30% 34.80% 0.88% 0.00% NA
Indica Intermediate  786 59.70% 38.80% 1.02% 0.51% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 98.30% 1.70% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 92.20% 6.70% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1004572532 C -> T LOC_Os10g08410.1 downstream_gene_variant ; 1666.0bp to feature; MODIFIER silent_mutation Average:50.35; most accessible tissue: Zhenshan97 flag leaf, score: 65.82 N N N N
vg1004572532 C -> T LOC_Os10g08420.1 downstream_gene_variant ; 257.0bp to feature; MODIFIER silent_mutation Average:50.35; most accessible tissue: Zhenshan97 flag leaf, score: 65.82 N N N N
vg1004572532 C -> T LOC_Os10g08410-LOC_Os10g08420 intergenic_region ; MODIFIER silent_mutation Average:50.35; most accessible tissue: Zhenshan97 flag leaf, score: 65.82 N N N N
vg1004572532 C -> DEL N N silent_mutation Average:50.35; most accessible tissue: Zhenshan97 flag leaf, score: 65.82 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1004572532 5.25E-07 NA mr1702 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004572532 5.37E-06 NA mr1702 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004572532 NA 5.79E-06 mr1992 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251