Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1004572532:

Variant ID: vg1004572532 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 4572532
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTCGGTTGAACAAGCACTAATCCTAGCCCCCAGCCGTGAAGTTGGAAAGTTCATTTCCGATTACGCGGCTTGGTTAATACGCATGGGGAGAACTCTTACA[C/T]
GACCAGGTCTGACATGGTCTTTCGTCTCTACAAAATCCGACAAGGCCTTATCGGCTCTGGGCGTCCCCAGCCGAAGATCCCTTAGGTTTCTCGGAGGCCT

Reverse complement sequence

AGGCCTCCGAGAAACCTAAGGGATCTTCGGCTGGGGACGCCCAGAGCCGATAAGGCCTTGTCGGATTTTGTAGAGACGAAAGACCATGTCAGACCTGGTC[G/A]
TGTAAGAGTTCTCCCCATGCGTATTAACCAAGCCGCGTAATCGGAAATGAACTTTCCAACTTCACGGCTGGGGGCTAGGATTAGTGCTTGTTCAACCGAG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	81.40%	17.70%	0.57%	0.36%	NA
All Indica	2759	68.60%	29.80%	0.94%	0.62%	NA
All Japonica	1512	99.50%	0.50%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	82.40%	17.60%	0.00%	0.00%	NA
Indica II	465	74.60%	20.40%	2.15%	2.80%	NA
Indica III	913	64.30%	34.80%	0.88%	0.00%	NA
Indica Intermediate	786	59.70%	38.80%	1.02%	0.51%	NA
Temperate Japonica	767	99.70%	0.30%	0.00%	0.00%	NA
Tropical Japonica	504	99.60%	0.40%	0.00%	0.00%	NA
Japonica Intermediate	241	98.30%	1.70%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	92.20%	6.70%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1004572532	C -> T	LOC_Os10g08410.1	downstream_gene_variant ; 1666.0bp to feature; MODIFIER	silent_mutation	Average:50.35; most accessible tissue: Zhenshan97 flag leaf, score: 65.82	N	N	N	N
vg1004572532	C -> T	LOC_Os10g08420.1	downstream_gene_variant ; 257.0bp to feature; MODIFIER	silent_mutation	Average:50.35; most accessible tissue: Zhenshan97 flag leaf, score: 65.82	N	N	N	N
vg1004572532	C -> T	LOC_Os10g08410-LOC_Os10g08420	intergenic_region ; MODIFIER	silent_mutation	Average:50.35; most accessible tissue: Zhenshan97 flag leaf, score: 65.82	N	N	N	N
vg1004572532	C -> DEL	N	N	silent_mutation	Average:50.35; most accessible tissue: Zhenshan97 flag leaf, score: 65.82	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1004572532	5.25E-07	NA	mr1702	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004572532	5.37E-06	NA	mr1702	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004572532	NA	5.79E-06	mr1992	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251