Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1004567845:

Variant ID: vg1004567845 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 4567845
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TACAATAAACTAGTTTCAAATTTTTAAATTTTATTTTCGCATACGGCTCCTTAAGATGCCCGTATGGAAAATTTCATTTTTCCATGCGGGCTTGATGAGG[G/T]
AGTTAGGTCCCGATCTACCGATAGGTATTGATCAACAGTCGATTTGGGCAGAGTCACGACACAACTCGATCTGGCTTCTGAACGAACACGCTACTGAGCC

Reverse complement sequence

GGCTCAGTAGCGTGTTCGTTCAGAAGCCAGATCGAGTTGTGTCGTGACTCTGCCCAAATCGACTGTTGATCAATACCTATCGGTAGATCGGGACCTAACT[C/A]
CCTCATCAAGCCCGCATGGAAAAATGAAATTTTCCATACGGGCATCTTAAGGAGCCGTATGCGAAAATAAAATTTAAAAATTTGAAACTAGTTTATTGTA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	65.50%	1.90%	2.22%	30.41%	NA
All Indica	2759	55.50%	0.30%	3.59%	40.59%	NA
All Japonica	1512	77.10%	4.30%	0.33%	18.25%	NA
Aus	269	95.50%	0.70%	0.00%	3.72%	NA
Indica I	595	61.20%	0.50%	1.01%	37.31%	NA
Indica II	465	44.50%	0.00%	9.89%	45.59%	NA
Indica III	913	50.90%	0.30%	2.52%	46.22%	NA
Indica Intermediate	786	63.10%	0.30%	3.05%	33.59%	NA
Temperate Japonica	767	85.70%	8.10%	0.26%	6.00%	NA
Tropical Japonica	504	67.90%	0.00%	0.20%	31.94%	NA
Japonica Intermediate	241	69.30%	1.20%	0.83%	28.63%	NA
VI/Aromatic	96	72.90%	14.60%	0.00%	12.50%	NA
Intermediate	90	77.80%	0.00%	1.11%	21.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1004567845	G -> T	LOC_Os10g08400.1	upstream_gene_variant ; 3846.0bp to feature; MODIFIER	silent_mutation	Average:23.783; most accessible tissue: Zhenshan97 flag leaf, score: 65.82	N	N	N	N
vg1004567845	G -> T	LOC_Os10g08410.1	upstream_gene_variant ; 1297.0bp to feature; MODIFIER	silent_mutation	Average:23.783; most accessible tissue: Zhenshan97 flag leaf, score: 65.82	N	N	N	N
vg1004567845	G -> T	LOC_Os10g08420.1	downstream_gene_variant ; 4944.0bp to feature; MODIFIER	silent_mutation	Average:23.783; most accessible tissue: Zhenshan97 flag leaf, score: 65.82	N	N	N	N
vg1004567845	G -> T	LOC_Os10g08400-LOC_Os10g08410	intergenic_region ; MODIFIER	silent_mutation	Average:23.783; most accessible tissue: Zhenshan97 flag leaf, score: 65.82	N	N	N	N
vg1004567845	G -> DEL	N	N	silent_mutation	Average:23.783; most accessible tissue: Zhenshan97 flag leaf, score: 65.82	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1004567845	2.67E-08	2.67E-08	mr1200	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004567845	7.43E-06	NA	mr1517	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251