\
| Variant ID: vg1004566041 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 4566041 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.92, T: 0.07, others allele: 0.00, population size: 200. )
TTCGACCTCAACAAATATATTTTGTTTGTGCATATTTGATTGTTGCTTGAATATTGGTTTTTTTTTCTCGCGTATTCTAGACTGTGTATCGGTTAGTCGT[G/T]
AGGCAACGTATGCAGCTTCCAGGAGGTGAAGGTTGATCAAGATTATATTAAGAATAAGAACTACTCTGAGCAGGCAAGTCATCACTATTCCTTGCACATG
CATGTGCAAGGAATAGTGATGACTTGCCTGCTCAGAGTAGTTCTTATTCTTAATATAATCTTGATCAACCTTCACCTCCTGGAAGCTGCATACGTTGCCT[C/A]
ACGACTAACCGATACACAGTCTAGAATACGCGAGAAAAAAAAACCAATATTCAAGCAACAATCAAATATGCACAAACAAAATATATTTGTTGAGGTCGAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.30% | 3.40% | 3.32% | 0.00% | NA |
| All Indica | 2759 | 95.90% | 0.50% | 3.55% | 0.00% | NA |
| All Japonica | 1512 | 89.20% | 7.80% | 3.04% | 0.00% | NA |
| Aus | 269 | 99.30% | 0.00% | 0.74% | 0.00% | NA |
| Indica I | 595 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.10% | 0.20% | 0.65% | 0.00% | NA |
| Indica III | 913 | 91.10% | 1.00% | 7.89% | 0.00% | NA |
| Indica Intermediate | 786 | 96.90% | 0.10% | 2.93% | 0.00% | NA |
| Temperate Japonica | 767 | 84.50% | 14.60% | 0.91% | 0.00% | NA |
| Tropical Japonica | 504 | 92.70% | 0.00% | 7.34% | 0.00% | NA |
| Japonica Intermediate | 241 | 96.70% | 2.50% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 63.50% | 26.00% | 10.42% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 3.30% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1004566041 | G -> T | LOC_Os10g08400.1 | upstream_gene_variant ; 2042.0bp to feature; MODIFIER | silent_mutation | Average:21.776; most accessible tissue: Minghui63 panicle, score: 38.588 | N | N | N | N |
| vg1004566041 | G -> T | LOC_Os10g08410.1 | upstream_gene_variant ; 3101.0bp to feature; MODIFIER | silent_mutation | Average:21.776; most accessible tissue: Minghui63 panicle, score: 38.588 | N | N | N | N |
| vg1004566041 | G -> T | LOC_Os10g08400-LOC_Os10g08410 | intergenic_region ; MODIFIER | silent_mutation | Average:21.776; most accessible tissue: Minghui63 panicle, score: 38.588 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1004566041 | 5.08E-06 | NA | mr1241 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004566041 | 2.73E-07 | 2.73E-07 | mr1973 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004566041 | NA | 2.05E-08 | mr1062_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |