\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1004560628:

Variant ID: vg1004560628 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 4560628
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.54, T: 0.46, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


TCTACCGGGTTTCAGCATGGTTTATAACCAGAGGAGACGTGGTGCTGTGACTGCGGGGCTCAGTAGCATGTTCGTTCAGAAGAAGGATCGAATTTCGTCA[C/T]
GACTCCGTCCAAATCGTCTGTTTATCAATACATATCGGAAGATCAGGACCTAACATCCTCATCATTTGTTCAGTCGCGTGACTACCGTGGGGAAAGGCCG

Reverse complement sequence

CGGCCTTTCCCCACGGTAGTCACGCGACTGAACAAATGATGAGGATGTTAGGTCCTGATCTTCCGATATGTATTGATAAACAGACGATTTGGACGGAGTC[G/A]
TGACGAAATTCGATCCTTCTTCTGAACGAACATGCTACTGAGCCCCGCAGTCACAGCACCACGTCTCCTCTGGTTATAAACCATGCTGAAACCCGGTAGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 43.40% 39.00% 0.61% 16.93% NA
All Indica  2759 33.70% 50.90% 0.69% 14.72% NA
All Japonica  1512 69.00% 23.10% 0.33% 7.54% NA
Aus  269 1.50% 5.20% 1.49% 91.82% NA
Indica I  595 20.00% 41.50% 1.51% 36.97% NA
Indica II  465 29.20% 60.60% 0.65% 9.46% NA
Indica III  913 36.00% 59.10% 0.11% 4.71% NA
Indica Intermediate  786 44.00% 42.60% 0.76% 12.60% NA
Temperate Japonica  767 72.80% 26.70% 0.13% 0.39% NA
Tropical Japonica  504 65.50% 12.90% 0.60% 21.03% NA
Japonica Intermediate  241 64.70% 32.80% 0.41% 2.07% NA
VI/Aromatic  96 30.20% 52.10% 0.00% 17.71% NA
Intermediate  90 51.10% 30.00% 1.11% 17.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1004560628 C -> T LOC_Os10g08390.1 downstream_gene_variant ; 2738.0bp to feature; MODIFIER silent_mutation Average:32.207; most accessible tissue: Minghui63 flag leaf, score: 61.847 N N N N
vg1004560628 C -> T LOC_Os10g08400.1 downstream_gene_variant ; 1921.0bp to feature; MODIFIER silent_mutation Average:32.207; most accessible tissue: Minghui63 flag leaf, score: 61.847 N N N N
vg1004560628 C -> T LOC_Os10g08390-LOC_Os10g08400 intergenic_region ; MODIFIER silent_mutation Average:32.207; most accessible tissue: Minghui63 flag leaf, score: 61.847 N N N N
vg1004560628 C -> DEL N N silent_mutation Average:32.207; most accessible tissue: Minghui63 flag leaf, score: 61.847 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1004560628 3.91E-06 NA mr1020 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004560628 8.57E-06 1.96E-08 mr1053 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004560628 NA 4.17E-06 mr1378 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004560628 5.10E-06 1.76E-06 mr1603 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004560628 5.36E-06 NA mr1735 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004560628 NA 1.85E-06 mr1937 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004560628 NA 5.68E-06 mr1308_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251