\
| Variant ID: vg1004560628 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 4560628 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.54, T: 0.46, others allele: 0.00, population size: 90. )
TCTACCGGGTTTCAGCATGGTTTATAACCAGAGGAGACGTGGTGCTGTGACTGCGGGGCTCAGTAGCATGTTCGTTCAGAAGAAGGATCGAATTTCGTCA[C/T]
GACTCCGTCCAAATCGTCTGTTTATCAATACATATCGGAAGATCAGGACCTAACATCCTCATCATTTGTTCAGTCGCGTGACTACCGTGGGGAAAGGCCG
CGGCCTTTCCCCACGGTAGTCACGCGACTGAACAAATGATGAGGATGTTAGGTCCTGATCTTCCGATATGTATTGATAAACAGACGATTTGGACGGAGTC[G/A]
TGACGAAATTCGATCCTTCTTCTGAACGAACATGCTACTGAGCCCCGCAGTCACAGCACCACGTCTCCTCTGGTTATAAACCATGCTGAAACCCGGTAGA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 43.40% | 39.00% | 0.61% | 16.93% | NA |
| All Indica | 2759 | 33.70% | 50.90% | 0.69% | 14.72% | NA |
| All Japonica | 1512 | 69.00% | 23.10% | 0.33% | 7.54% | NA |
| Aus | 269 | 1.50% | 5.20% | 1.49% | 91.82% | NA |
| Indica I | 595 | 20.00% | 41.50% | 1.51% | 36.97% | NA |
| Indica II | 465 | 29.20% | 60.60% | 0.65% | 9.46% | NA |
| Indica III | 913 | 36.00% | 59.10% | 0.11% | 4.71% | NA |
| Indica Intermediate | 786 | 44.00% | 42.60% | 0.76% | 12.60% | NA |
| Temperate Japonica | 767 | 72.80% | 26.70% | 0.13% | 0.39% | NA |
| Tropical Japonica | 504 | 65.50% | 12.90% | 0.60% | 21.03% | NA |
| Japonica Intermediate | 241 | 64.70% | 32.80% | 0.41% | 2.07% | NA |
| VI/Aromatic | 96 | 30.20% | 52.10% | 0.00% | 17.71% | NA |
| Intermediate | 90 | 51.10% | 30.00% | 1.11% | 17.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1004560628 | C -> T | LOC_Os10g08390.1 | downstream_gene_variant ; 2738.0bp to feature; MODIFIER | silent_mutation | Average:32.207; most accessible tissue: Minghui63 flag leaf, score: 61.847 | N | N | N | N |
| vg1004560628 | C -> T | LOC_Os10g08400.1 | downstream_gene_variant ; 1921.0bp to feature; MODIFIER | silent_mutation | Average:32.207; most accessible tissue: Minghui63 flag leaf, score: 61.847 | N | N | N | N |
| vg1004560628 | C -> T | LOC_Os10g08390-LOC_Os10g08400 | intergenic_region ; MODIFIER | silent_mutation | Average:32.207; most accessible tissue: Minghui63 flag leaf, score: 61.847 | N | N | N | N |
| vg1004560628 | C -> DEL | N | N | silent_mutation | Average:32.207; most accessible tissue: Minghui63 flag leaf, score: 61.847 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1004560628 | 3.91E-06 | NA | mr1020 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004560628 | 8.57E-06 | 1.96E-08 | mr1053 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004560628 | NA | 4.17E-06 | mr1378 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004560628 | 5.10E-06 | 1.76E-06 | mr1603 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004560628 | 5.36E-06 | NA | mr1735 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004560628 | NA | 1.85E-06 | mr1937 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004560628 | NA | 5.68E-06 | mr1308_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |