\
| Variant ID: vg1004555361 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 4555361 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, T: 0.00, others allele: 0.00, population size: 222. )
ACGTCGCCTTGGGGTGTTCCGGTAATCTTTGTGGAAAAGAAAGACAAAACCAAGAGGATGTGTGTTGACTACCGCACGCTCAATGAGGTCACTATTAAGA[A/T]
CAAGTACCCTTTGCCAAGGATTGATGATCTGTTTGATCAGTTGAAAGGAGCTACTATGTTCTCTAAGATAGACCTGCGATCAGGCTATCACCAGTTGAGG
CCTCAACTGGTGATAGCCTGATCGCAGGTCTATCTTAGAGAACATAGTAGCTCCTTTCAACTGATCAAACAGATCATCAATCCTTGGCAAAGGGTACTTG[T/A]
TCTTAATAGTGACCTCATTGAGCGTGCGGTAGTCAACACACATCCTCTTGGTTTTGTCTTTCTTTTCCACAAAGATTACCGGAACACCCCAAGGCGACGT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 31.00% | 25.10% | 1.99% | 41.94% | NA |
| All Indica | 2759 | 13.80% | 41.30% | 2.32% | 42.59% | NA |
| All Japonica | 1512 | 65.40% | 1.10% | 1.39% | 32.14% | NA |
| Aus | 269 | 4.10% | 2.60% | 1.12% | 92.19% | NA |
| Indica I | 595 | 2.70% | 40.80% | 2.69% | 53.78% | NA |
| Indica II | 465 | 16.10% | 48.60% | 1.94% | 33.33% | NA |
| Indica III | 913 | 22.00% | 41.30% | 1.86% | 34.83% | NA |
| Indica Intermediate | 786 | 11.30% | 37.30% | 2.80% | 48.60% | NA |
| Temperate Japonica | 767 | 93.70% | 0.90% | 0.39% | 4.95% | NA |
| Tropical Japonica | 504 | 19.20% | 0.60% | 2.98% | 77.18% | NA |
| Japonica Intermediate | 241 | 71.80% | 2.50% | 1.24% | 24.48% | NA |
| VI/Aromatic | 96 | 53.10% | 1.00% | 5.21% | 40.62% | NA |
| Intermediate | 90 | 34.40% | 26.70% | 1.11% | 37.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1004555361 | A -> T | LOC_Os10g08390.1 | missense_variant ; p.Asn421Ile; MODERATE | nonsynonymous_codon | Average:29.243; most accessible tissue: Minghui63 flag leaf, score: 69.182 | benign |
0.858 |
DELETERIOUS | 0.00 |
| vg1004555361 | A -> DEL | LOC_Os10g08390.1 | N | frameshift_variant | Average:29.243; most accessible tissue: Minghui63 flag leaf, score: 69.182 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1004555361 | NA | 4.02E-07 | mr1053 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004555361 | NA | 1.21E-08 | mr1053_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004555361 | NA | 1.70E-06 | mr1053_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004555361 | 8.15E-06 | 8.15E-06 | mr1151_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004555361 | NA | 5.79E-06 | mr1220_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004555361 | NA | 3.01E-06 | mr1250_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004555361 | NA | 5.33E-06 | mr1308_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004555361 | 1.18E-06 | 1.18E-06 | mr1433_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004555361 | NA | 4.50E-06 | mr1691_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004555361 | NA | 3.70E-06 | mr1729_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004555361 | NA | 1.09E-06 | mr1852_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004555361 | NA | 7.78E-06 | mr1887_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |