\
| Variant ID: vg1004552820 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 4552820 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.93, A: 0.06, others allele: 0.00, population size: 191. )
GGATTCGTTTCGGGAAAATTTGGGGTTTATGCCTCTTTGGTTTGCGAAAAAAATCTTAGTCATTCATTCGGATCGGATCTTTATAATTAGCTCAGTCTAG[G/A]
GTTTTAGTAATATTTTATTCGGAGTTTATTCGAAAGTCAGTCGGGAATTTATCGGGTGATATGCATTAGGTCGTGTCTATGTTCAATGGGGCAATTTTAT
ATAAAATTGCCCCATTGAACATAGACACGACCTAATGCATATCACCCGATAAATTCCCGACTGACTTTCGAATAAACTCCGAATAAAATATTACTAAAAC[C/T]
CTAGACTGAGCTAATTATAAAGATCCGATCCGAATGAATGACTAAGATTTTTTTCGCAAACCAAAGAGGCATAAACCCCAAATTTTCCCGAAACGAATCC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 50.40% | 32.10% | 0.61% | 16.91% | NA |
| All Indica | 2759 | 38.00% | 46.60% | 0.72% | 14.68% | NA |
| All Japonica | 1512 | 80.20% | 12.00% | 0.13% | 7.67% | NA |
| Aus | 269 | 2.60% | 4.80% | 1.86% | 90.71% | NA |
| Indica I | 595 | 20.50% | 40.80% | 1.34% | 37.31% | NA |
| Indica II | 465 | 29.90% | 59.40% | 1.08% | 9.68% | NA |
| Indica III | 913 | 45.80% | 49.70% | 0.22% | 4.27% | NA |
| Indica Intermediate | 786 | 47.10% | 39.70% | 0.64% | 12.60% | NA |
| Temperate Japonica | 767 | 93.60% | 6.10% | 0.13% | 0.13% | NA |
| Tropical Japonica | 504 | 65.90% | 12.30% | 0.20% | 21.63% | NA |
| Japonica Intermediate | 241 | 67.60% | 29.90% | 0.00% | 2.49% | NA |
| VI/Aromatic | 96 | 64.60% | 15.60% | 2.08% | 17.71% | NA |
| Intermediate | 90 | 55.60% | 25.60% | 0.00% | 18.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1004552820 | G -> A | LOC_Os10g08390.1 | upstream_gene_variant ; 598.0bp to feature; MODIFIER | silent_mutation | Average:23.565; most accessible tissue: Callus, score: 56.872 | N | N | N | N |
| vg1004552820 | G -> A | LOC_Os10g08370-LOC_Os10g08390 | intergenic_region ; MODIFIER | silent_mutation | Average:23.565; most accessible tissue: Callus, score: 56.872 | N | N | N | N |
| vg1004552820 | G -> DEL | N | N | silent_mutation | Average:23.565; most accessible tissue: Callus, score: 56.872 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1004552820 | NA | 1.59E-06 | mr1053_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004552820 | NA | 5.59E-07 | mr1308_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004552820 | NA | 9.57E-06 | mr1318_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004552820 | NA | 1.70E-06 | mr1603_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004552820 | NA | 1.79E-06 | mr1603_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004552820 | NA | 9.44E-06 | mr1729_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004552820 | NA | 2.35E-06 | mr1852_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004552820 | 6.11E-06 | 6.11E-06 | mr1853_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004552820 | NA | 1.99E-06 | mr1887_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004552820 | 2.98E-06 | NA | mr1897_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |