\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1004552820:

Variant ID: vg1004552820 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 4552820
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.93, A: 0.06, others allele: 0.00, population size: 191. )

Flanking Sequence (100 bp) in Reference Genome:


GGATTCGTTTCGGGAAAATTTGGGGTTTATGCCTCTTTGGTTTGCGAAAAAAATCTTAGTCATTCATTCGGATCGGATCTTTATAATTAGCTCAGTCTAG[G/A]
GTTTTAGTAATATTTTATTCGGAGTTTATTCGAAAGTCAGTCGGGAATTTATCGGGTGATATGCATTAGGTCGTGTCTATGTTCAATGGGGCAATTTTAT

Reverse complement sequence

ATAAAATTGCCCCATTGAACATAGACACGACCTAATGCATATCACCCGATAAATTCCCGACTGACTTTCGAATAAACTCCGAATAAAATATTACTAAAAC[C/T]
CTAGACTGAGCTAATTATAAAGATCCGATCCGAATGAATGACTAAGATTTTTTTCGCAAACCAAAGAGGCATAAACCCCAAATTTTCCCGAAACGAATCC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.40% 32.10% 0.61% 16.91% NA
All Indica  2759 38.00% 46.60% 0.72% 14.68% NA
All Japonica  1512 80.20% 12.00% 0.13% 7.67% NA
Aus  269 2.60% 4.80% 1.86% 90.71% NA
Indica I  595 20.50% 40.80% 1.34% 37.31% NA
Indica II  465 29.90% 59.40% 1.08% 9.68% NA
Indica III  913 45.80% 49.70% 0.22% 4.27% NA
Indica Intermediate  786 47.10% 39.70% 0.64% 12.60% NA
Temperate Japonica  767 93.60% 6.10% 0.13% 0.13% NA
Tropical Japonica  504 65.90% 12.30% 0.20% 21.63% NA
Japonica Intermediate  241 67.60% 29.90% 0.00% 2.49% NA
VI/Aromatic  96 64.60% 15.60% 2.08% 17.71% NA
Intermediate  90 55.60% 25.60% 0.00% 18.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1004552820 G -> A LOC_Os10g08390.1 upstream_gene_variant ; 598.0bp to feature; MODIFIER silent_mutation Average:23.565; most accessible tissue: Callus, score: 56.872 N N N N
vg1004552820 G -> A LOC_Os10g08370-LOC_Os10g08390 intergenic_region ; MODIFIER silent_mutation Average:23.565; most accessible tissue: Callus, score: 56.872 N N N N
vg1004552820 G -> DEL N N silent_mutation Average:23.565; most accessible tissue: Callus, score: 56.872 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1004552820 NA 1.59E-06 mr1053_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004552820 NA 5.59E-07 mr1308_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004552820 NA 9.57E-06 mr1318_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004552820 NA 1.70E-06 mr1603_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004552820 NA 1.79E-06 mr1603_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004552820 NA 9.44E-06 mr1729_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004552820 NA 2.35E-06 mr1852_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004552820 6.11E-06 6.11E-06 mr1853_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004552820 NA 1.99E-06 mr1887_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004552820 2.98E-06 NA mr1897_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251