Variant ID: vg1004546341 (JBrowse) | Variation Type: SNP |
Chromosome: chr10 | Position: 4546341 |
Reference Allele: A | Alternative Allele: G |
Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
GACATAACTTACTCAAGAACGAAATGAAATCTGCATATAGTCAGTAGCAACTAAATTTACATTTTCTGTATGTAATTAATCATATATTGTTTGAAGGGGA[A/G]
ACTTAGTGTAGGATTCATGGGCAATGGCTGAGTTCGACAATATGAGGGGCTTATAATAGGTGTATCCCCAAGCTGAAAACTGAGCAGATTTTTGTAGTGC
GCACTACAAAAATCTGCTCAGTTTTCAGCTTGGGGATACACCTATTATAAGCCCCTCATATTGTCGAACTCAGCCATTGCCCATGAATCCTACACTAAGT[T/C]
TCCCCTTCAAACAATATATGATTAATTACATACAGAAAATGTAAATTTAGTTGCTACTGACTATATGCAGATTTCATTTCGTTCTTGAGTAAGTTATGTC
Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 96.80% | 1.50% | 0.78% | 0.87% | NA |
All Indica | 2759 | 99.70% | 0.00% | 0.22% | 0.04% | NA |
All Japonica | 1512 | 92.10% | 4.80% | 1.06% | 2.12% | NA |
Aus | 269 | 95.90% | 0.00% | 2.60% | 1.49% | NA |
Indica I | 595 | 99.50% | 0.00% | 0.34% | 0.17% | NA |
Indica II | 465 | 99.80% | 0.00% | 0.22% | 0.00% | NA |
Indica III | 913 | 99.80% | 0.00% | 0.22% | 0.00% | NA |
Indica Intermediate | 786 | 99.90% | 0.00% | 0.13% | 0.00% | NA |
Temperate Japonica | 767 | 90.60% | 9.40% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 90.70% | 0.00% | 3.17% | 6.15% | NA |
Japonica Intermediate | 241 | 99.60% | 0.00% | 0.00% | 0.41% | NA |
VI/Aromatic | 96 | 91.70% | 0.00% | 4.17% | 4.17% | NA |
Intermediate | 90 | 95.60% | 0.00% | 4.44% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg1004546341 | A -> G | LOC_Os10g08370-LOC_Os10g08390 | intergenic_region ; MODIFIER | silent_mutation | Average:31.736; most accessible tissue: Minghui63 young leaf, score: 56.213 | N | N | N | N |
vg1004546341 | A -> DEL | N | N | silent_mutation | Average:31.736; most accessible tissue: Minghui63 young leaf, score: 56.213 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg1004546341 | NA | 9.53E-07 | mr1210 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1004546341 | NA | 2.40E-06 | mr1305 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1004546341 | NA | 1.37E-08 | mr1585 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1004546341 | NA | 7.27E-07 | mr1586 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1004546341 | NA | 9.95E-06 | mr1765 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1004546341 | 1.28E-07 | 4.81E-11 | mr1305_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1004546341 | 4.13E-07 | 4.13E-07 | mr1317_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1004546341 | 9.71E-07 | 1.78E-08 | mr1559_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1004546341 | 1.64E-07 | 2.33E-13 | mr1585_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1004546341 | NA | 6.69E-06 | mr1703_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |