| Variant ID: vg1004538986 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 4538986 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, G: 0.00, others allele: 0.00, population size: 200. )
GACGCCGGATATCGACTTAAGAGATAAGCATGGCTAGCCCCCTACAGTGTTTACGGATACTGTCAGGAGAGACATAGCGCTGTCTTTGATCTCACCGGAT[A/G]
CGGATTCGAGGAGGAAGGCTACCCTGTTGTCGACTACGAGTCAGCACTTTAGACCGCCAAGTCGACAACAGTTAGATAGGCTACCCCAAATATTGTACAG
CTGTACAATATTTGGGGTAGCCTATCTAACTGTTGTCGACTTGGCGGTCTAAAGTGCTGACTCGTAGTCGACAACAGGGTAGCCTTCCTCCTCGAATCCG[T/C]
ATCCGGTGAGATCAAAGACAGCGCTATGTCTCTCCTGACAGTATCCGTAAACACTGTAGGGGGCTAGCCATGCTTATCTCTTAAGTCGATATCCGGCGTC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 49.90% | 4.10% | 5.12% | 40.88% | NA |
| All Indica | 2759 | 43.00% | 3.70% | 6.52% | 46.79% | NA |
| All Japonica | 1512 | 51.70% | 4.80% | 3.57% | 39.95% | NA |
| Aus | 269 | 97.40% | 1.10% | 1.12% | 0.37% | NA |
| Indica I | 595 | 49.40% | 1.30% | 3.36% | 45.88% | NA |
| Indica II | 465 | 29.00% | 1.90% | 7.10% | 61.94% | NA |
| Indica III | 913 | 49.80% | 6.20% | 7.34% | 36.58% | NA |
| Indica Intermediate | 786 | 38.50% | 3.40% | 7.63% | 50.38% | NA |
| Temperate Japonica | 767 | 80.80% | 8.10% | 0.65% | 10.43% | NA |
| Tropical Japonica | 504 | 9.50% | 0.80% | 7.94% | 81.75% | NA |
| Japonica Intermediate | 241 | 46.90% | 2.90% | 3.73% | 46.47% | NA |
| VI/Aromatic | 96 | 72.90% | 14.60% | 2.08% | 10.42% | NA |
| Intermediate | 90 | 62.20% | 5.60% | 3.33% | 28.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1004538986 | A -> G | LOC_Os10g08370.1 | downstream_gene_variant ; 2660.0bp to feature; MODIFIER | silent_mutation | Average:27.4; most accessible tissue: Zhenshan97 flag leaf, score: 69.147 | N | N | N | N |
| vg1004538986 | A -> G | LOC_Os10g08370-LOC_Os10g08390 | intergenic_region ; MODIFIER | silent_mutation | Average:27.4; most accessible tissue: Zhenshan97 flag leaf, score: 69.147 | N | N | N | N |
| vg1004538986 | A -> DEL | N | N | silent_mutation | Average:27.4; most accessible tissue: Zhenshan97 flag leaf, score: 69.147 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1004538986 | 1.20E-06 | 1.20E-06 | mr1067 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004538986 | 3.85E-07 | 3.85E-07 | mr1526 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004538986 | 1.47E-06 | 1.47E-06 | mr1855 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004538986 | 6.14E-07 | 6.14E-07 | mr1973 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004538986 | NA | 4.22E-06 | mr1062_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |