\
| Variant ID: vg1004535011 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 4535011 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
TACCGGTCTAACTATGGATCAGCTGATTGGAGCCGCACCAATCCCGAAGGCGAAAGTGGCATACAAGTTTGAACTCGGTAAACCGCTTGTCTCGCCTGAG[T/C]
AGCTGCAGTCCCTACCGACACAGATGTACAAATTCCATGAATGGTACATGGAAATGAGCGCCAAGGGTAGAGAGATGTTCGGAGTGAGGATCAGAAACCC
GGGTTTCTGATCCTCACTCCGAACATCTCTCTACCCTTGGCGCTCATTTCCATGTACCATTCATGGAATTTGTACATCTGTGTCGGTAGGGACTGCAGCT[A/G]
CTCAGGCGAGACAAGCGGTTTACCGAGTTCAAACTTGTATGCCACTTTCGCCTTCGGGATTGGTGCGGCTCCAATCAGCTGATCCATAGTTAGACCGGTA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 24.50% | 6.90% | 32.61% | 36.08% | NA |
| All Indica | 2759 | 15.00% | 4.60% | 44.40% | 35.92% | NA |
| All Japonica | 1512 | 44.30% | 9.60% | 3.57% | 42.53% | NA |
| Aus | 269 | 15.60% | 2.60% | 77.70% | 4.09% | NA |
| Indica I | 595 | 10.40% | 0.80% | 52.10% | 36.64% | NA |
| Indica II | 465 | 18.30% | 1.10% | 47.31% | 33.33% | NA |
| Indica III | 913 | 15.10% | 9.90% | 38.55% | 36.47% | NA |
| Indica Intermediate | 786 | 16.50% | 3.60% | 43.64% | 36.26% | NA |
| Temperate Japonica | 767 | 70.90% | 17.70% | 1.30% | 10.04% | NA |
| Tropical Japonica | 504 | 5.40% | 0.40% | 5.56% | 88.69% | NA |
| Japonica Intermediate | 241 | 41.10% | 2.90% | 6.64% | 49.38% | NA |
| VI/Aromatic | 96 | 2.10% | 35.40% | 26.04% | 36.46% | NA |
| Intermediate | 90 | 30.00% | 11.10% | 31.11% | 27.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1004535011 | T -> C | LOC_Os10g08370.1 | splice_region_variant&intron_variant ; LOW | silent_mutation | Average:17.799; most accessible tissue: Callus, score: 33.264 | N | N | N | N |
| vg1004535011 | T -> C | LOC_Os10g08360.1 | downstream_gene_variant ; 1130.0bp to feature; MODIFIER | silent_mutation | Average:17.799; most accessible tissue: Callus, score: 33.264 | N | N | N | N |
| vg1004535011 | T -> DEL | N | N | silent_mutation | Average:17.799; most accessible tissue: Callus, score: 33.264 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1004535011 | NA | 3.59E-09 | mr1062_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004535011 | NA | 3.16E-06 | mr1305_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004535011 | NA | 7.31E-06 | mr1559_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004535011 | NA | 3.17E-08 | mr1585_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004535011 | 3.42E-06 | NA | mr1765_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |