Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1004522984:

Variant ID: vg1004522984 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 4522984
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.93, A: 0.07, others allele: 0.00, population size: 108. )

Flanking Sequence (100 bp) in Reference Genome:

AGAAGGGAGAAAAAAAGAAAATAATAATAATAATGTGCGATGTCGTCGTCTACATGGCATGCCACATAGGCAAGACCACGGTCAAATGAGACTTTGGACC[G/A]
GAAAGACATAATAAACCAAGTTTAGGGACCTCGATACATACACTAAAGATGATCTTTAGTCCCGGTTAAAAAGGGTAACGGGCATATTTGATCTTTAGTC

Reverse complement sequence

GACTAAAGATCAAATATGCCCGTTACCCTTTTTAACCGGGACTAAAGATCATCTTTAGTGTATGTATCGAGGTCCCTAAACTTGGTTTATTATGTCTTTC[C/T]
GGTCCAAAGTCTCATTTGACCGTGGTCTTGCCTATGTGGCATGCCATGTAGACGACGACATCGCACATTATTATTATTATTTTCTTTTTTTCTCCCTTCT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	80.90%	16.60%	0.08%	2.43%	NA
All Indica	2759	84.40%	15.30%	0.04%	0.29%	NA
All Japonica	1512	88.00%	5.00%	0.20%	6.88%	NA
Aus	269	5.20%	94.80%	0.00%	0.00%	NA
Indica I	595	59.50%	40.30%	0.17%	0.00%	NA
Indica II	465	89.90%	10.10%	0.00%	0.00%	NA
Indica III	913	95.70%	3.40%	0.00%	0.88%	NA
Indica Intermediate	786	86.90%	13.10%	0.00%	0.00%	NA
Temperate Japonica	767	96.70%	3.00%	0.26%	0.00%	NA
Tropical Japonica	504	76.20%	3.60%	0.00%	20.24%	NA
Japonica Intermediate	241	84.60%	14.10%	0.41%	0.83%	NA
VI/Aromatic	96	80.20%	19.80%	0.00%	0.00%	NA
Intermediate	90	78.90%	17.80%	0.00%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1004522984	G -> A	LOC_Os10g08350.1	upstream_gene_variant ; 1029.0bp to feature; MODIFIER	silent_mutation	Average:44.68; most accessible tissue: Zhenshan97 young leaf, score: 59.612	N	N	N	N
vg1004522984	G -> A	LOC_Os10g08340-LOC_Os10g08350	intergenic_region ; MODIFIER	silent_mutation	Average:44.68; most accessible tissue: Zhenshan97 young leaf, score: 59.612	N	N	N	N
vg1004522984	G -> DEL	N	N	silent_mutation	Average:44.68; most accessible tissue: Zhenshan97 young leaf, score: 59.612	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1004522984	NA	7.51E-07	mr1140	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004522984	NA	7.24E-06	mr1203	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004522984	NA	2.88E-07	mr1395	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004522984	NA	1.62E-07	mr1613	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004522984	NA	6.46E-06	mr1618	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004522984	2.30E-06	6.29E-09	mr1913	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004522984	NA	1.29E-06	mr1071_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004522984	6.94E-08	NA	mr1100_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004522984	2.71E-07	2.49E-09	mr1100_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004522984	NA	3.77E-07	mr1203_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004522984	NA	6.26E-08	mr1613_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004522984	NA	1.51E-06	mr1913_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251