\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1004519208:

Variant ID: vg1004519208 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 4519208
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.00, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:


GGTTAGAAAAAATGATATGATACGGTTTATTGAGAGAAGAGATAAATATCATTAACTACAATTATTAGGATAAACTTTAATAGATATTTATGACAAGTAA[A/G]
CTAGATGAGAGCCTTTGGACCATACAGCACGATTGATCAACCCTATCTGTAAATTTAGGCAACGTAGGAACTTCAAAACCTACTAGATCAAGTGAATACG

Reverse complement sequence

CGTATTCACTTGATCTAGTAGGTTTTGAAGTTCCTACGTTGCCTAAATTTACAGATAGGGTTGATCAATCGTGCTGTATGGTCCAAAGGCTCTCATCTAG[T/C]
TTACTTGTCATAAATATCTATTAAAGTTTATCCTAATAATTGTAGTTAATGATATTTATCTCTTCTCTCAATAAACCGTATCATATCATTTTTTCTAACC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.40% 13.10% 0.00% 2.43% NA
All Indica  2759 99.10% 0.60% 0.00% 0.29% NA
All Japonica  1512 54.00% 39.10% 0.00% 6.88% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.70% 0.30% 0.00% 0.00% NA
Indica II  465 98.70% 1.30% 0.00% 0.00% NA
Indica III  913 99.00% 0.10% 0.00% 0.88% NA
Indica Intermediate  786 99.10% 0.90% 0.00% 0.00% NA
Temperate Japonica  767 33.60% 66.40% 0.00% 0.00% NA
Tropical Japonica  504 76.80% 3.00% 0.00% 20.24% NA
Japonica Intermediate  241 71.40% 27.80% 0.00% 0.83% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 82.20% 14.40% 0.00% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1004519208 A -> G LOC_Os10g08340.1 upstream_gene_variant ; 3854.0bp to feature; MODIFIER silent_mutation Average:55.243; most accessible tissue: Callus, score: 93.444 N N N N
vg1004519208 A -> G LOC_Os10g08350.1 upstream_gene_variant ; 4805.0bp to feature; MODIFIER silent_mutation Average:55.243; most accessible tissue: Callus, score: 93.444 N N N N
vg1004519208 A -> G LOC_Os10g08340-LOC_Os10g08350 intergenic_region ; MODIFIER silent_mutation Average:55.243; most accessible tissue: Callus, score: 93.444 N N N N
vg1004519208 A -> DEL N N silent_mutation Average:55.243; most accessible tissue: Callus, score: 93.444 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1004519208 NA 3.70E-19 mr1768 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004519208 4.53E-06 NA mr1403_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004519208 NA 1.79E-07 mr1446_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004519208 NA 1.16E-08 mr1606_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004519208 1.67E-06 3.87E-29 mr1768_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004519208 NA 4.64E-06 mr1768_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004519208 NA 3.83E-06 mr1869_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004519208 NA 7.13E-19 mr1980_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004519208 NA 3.84E-06 mr1980_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251