\
| Variant ID: vg1004519208 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 4519208 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.00, others allele: 0.00, population size: 245. )
GGTTAGAAAAAATGATATGATACGGTTTATTGAGAGAAGAGATAAATATCATTAACTACAATTATTAGGATAAACTTTAATAGATATTTATGACAAGTAA[A/G]
CTAGATGAGAGCCTTTGGACCATACAGCACGATTGATCAACCCTATCTGTAAATTTAGGCAACGTAGGAACTTCAAAACCTACTAGATCAAGTGAATACG
CGTATTCACTTGATCTAGTAGGTTTTGAAGTTCCTACGTTGCCTAAATTTACAGATAGGGTTGATCAATCGTGCTGTATGGTCCAAAGGCTCTCATCTAG[T/C]
TTACTTGTCATAAATATCTATTAAAGTTTATCCTAATAATTGTAGTTAATGATATTTATCTCTTCTCTCAATAAACCGTATCATATCATTTTTTCTAACC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 84.40% | 13.10% | 0.00% | 2.43% | NA |
| All Indica | 2759 | 99.10% | 0.60% | 0.00% | 0.29% | NA |
| All Japonica | 1512 | 54.00% | 39.10% | 0.00% | 6.88% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.00% | 0.10% | 0.00% | 0.88% | NA |
| Indica Intermediate | 786 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 33.60% | 66.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 76.80% | 3.00% | 0.00% | 20.24% | NA |
| Japonica Intermediate | 241 | 71.40% | 27.80% | 0.00% | 0.83% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 82.20% | 14.40% | 0.00% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1004519208 | A -> G | LOC_Os10g08340.1 | upstream_gene_variant ; 3854.0bp to feature; MODIFIER | silent_mutation | Average:55.243; most accessible tissue: Callus, score: 93.444 | N | N | N | N |
| vg1004519208 | A -> G | LOC_Os10g08350.1 | upstream_gene_variant ; 4805.0bp to feature; MODIFIER | silent_mutation | Average:55.243; most accessible tissue: Callus, score: 93.444 | N | N | N | N |
| vg1004519208 | A -> G | LOC_Os10g08340-LOC_Os10g08350 | intergenic_region ; MODIFIER | silent_mutation | Average:55.243; most accessible tissue: Callus, score: 93.444 | N | N | N | N |
| vg1004519208 | A -> DEL | N | N | silent_mutation | Average:55.243; most accessible tissue: Callus, score: 93.444 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1004519208 | NA | 3.70E-19 | mr1768 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004519208 | 4.53E-06 | NA | mr1403_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004519208 | NA | 1.79E-07 | mr1446_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004519208 | NA | 1.16E-08 | mr1606_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004519208 | 1.67E-06 | 3.87E-29 | mr1768_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004519208 | NA | 4.64E-06 | mr1768_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004519208 | NA | 3.83E-06 | mr1869_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004519208 | NA | 7.13E-19 | mr1980_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004519208 | NA | 3.84E-06 | mr1980_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |