\
| Variant ID: vg1004482207 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 4482207 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 254. )
GACCAAACGTCCGACGGGAGACAATTCATCGGATGCTACACCCACCGAGCCCACTTCACTCCCAACGACCATCCATCCCTATCCCCACCTCTCTCACTTC[C/T]
CTCATCTCTCATCTCTCTATCCAAGCAGTCCGCTGTGATAAACATGATAAATCGTGCGTCGCCGCCACTCCTGCTACACACTCCTGAGCCGTTGTCAACC
GGTTGACAACGGCTCAGGAGTGTGTAGCAGGAGTGGCGGCGACGCACGATTTATCATGTTTATCACAGCGGACTGCTTGGATAGAGAGATGAGAGATGAG[G/A]
GAAGTGAGAGAGGTGGGGATAGGGATGGATGGTCGTTGGGAGTGAAGTGGGCTCGGTGGGTGTAGCATCCGATGAATTGTCTCCCGTCGGACGTTTGGTC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 98.50% | 1.40% | 0.08% | 0.00% | NA |
| All Indica | 2759 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 95.70% | 4.00% | 0.26% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 96.30% | 3.30% | 0.39% | 0.00% | NA |
| Tropical Japonica | 504 | 98.20% | 1.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 88.40% | 11.20% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1004482207 | C -> T | LOC_Os10g08300.1 | upstream_gene_variant ; 2069.0bp to feature; MODIFIER | silent_mutation | Average:64.735; most accessible tissue: Zhenshan97 young leaf, score: 89.559 | N | N | N | N |
| vg1004482207 | C -> T | LOC_Os10g08280.1 | downstream_gene_variant ; 2319.0bp to feature; MODIFIER | silent_mutation | Average:64.735; most accessible tissue: Zhenshan97 young leaf, score: 89.559 | N | N | N | N |
| vg1004482207 | C -> T | LOC_Os10g08290.1 | downstream_gene_variant ; 802.0bp to feature; MODIFIER | silent_mutation | Average:64.735; most accessible tissue: Zhenshan97 young leaf, score: 89.559 | N | N | N | N |
| vg1004482207 | C -> T | LOC_Os10g08290-LOC_Os10g08300 | intergenic_region ; MODIFIER | silent_mutation | Average:64.735; most accessible tissue: Zhenshan97 young leaf, score: 89.559 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1004482207 | NA | 1.46E-06 | mr1071 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004482207 | NA | 6.88E-06 | mr1100 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004482207 | NA | 2.90E-07 | mr1140 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004482207 | NA | 3.97E-06 | mr1203 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004482207 | NA | 3.11E-07 | mr1395 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004482207 | NA | 8.05E-08 | mr1613 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004482207 | NA | 1.82E-06 | mr1618 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004482207 | 1.28E-08 | 5.60E-13 | mr1913 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004482207 | NA | 5.92E-07 | mr1071_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004482207 | 1.58E-06 | 9.72E-10 | mr1100_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004482207 | NA | 1.27E-07 | mr1203_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004482207 | NA | 1.22E-08 | mr1613_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004482207 | 6.18E-06 | 3.92E-07 | mr1795_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004482207 | 6.88E-06 | 3.73E-09 | mr1913_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |