\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1004482207:

Variant ID: vg1004482207 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 4482207
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:


GACCAAACGTCCGACGGGAGACAATTCATCGGATGCTACACCCACCGAGCCCACTTCACTCCCAACGACCATCCATCCCTATCCCCACCTCTCTCACTTC[C/T]
CTCATCTCTCATCTCTCTATCCAAGCAGTCCGCTGTGATAAACATGATAAATCGTGCGTCGCCGCCACTCCTGCTACACACTCCTGAGCCGTTGTCAACC

Reverse complement sequence

GGTTGACAACGGCTCAGGAGTGTGTAGCAGGAGTGGCGGCGACGCACGATTTATCATGTTTATCACAGCGGACTGCTTGGATAGAGAGATGAGAGATGAG[G/A]
GAAGTGAGAGAGGTGGGGATAGGGATGGATGGTCGTTGGGAGTGAAGTGGGCTCGGTGGGTGTAGCATCCGATGAATTGTCTCCCGTCGGACGTTTGGTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 98.50% 1.40% 0.08% 0.00% NA
All Indica  2759 99.90% 0.10% 0.00% 0.00% NA
All Japonica  1512 95.70% 4.00% 0.26% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 99.90% 0.10% 0.00% 0.00% NA
Temperate Japonica  767 96.30% 3.30% 0.39% 0.00% NA
Tropical Japonica  504 98.20% 1.80% 0.00% 0.00% NA
Japonica Intermediate  241 88.40% 11.20% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 95.60% 4.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1004482207 C -> T LOC_Os10g08300.1 upstream_gene_variant ; 2069.0bp to feature; MODIFIER silent_mutation Average:64.735; most accessible tissue: Zhenshan97 young leaf, score: 89.559 N N N N
vg1004482207 C -> T LOC_Os10g08280.1 downstream_gene_variant ; 2319.0bp to feature; MODIFIER silent_mutation Average:64.735; most accessible tissue: Zhenshan97 young leaf, score: 89.559 N N N N
vg1004482207 C -> T LOC_Os10g08290.1 downstream_gene_variant ; 802.0bp to feature; MODIFIER silent_mutation Average:64.735; most accessible tissue: Zhenshan97 young leaf, score: 89.559 N N N N
vg1004482207 C -> T LOC_Os10g08290-LOC_Os10g08300 intergenic_region ; MODIFIER silent_mutation Average:64.735; most accessible tissue: Zhenshan97 young leaf, score: 89.559 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1004482207 NA 1.46E-06 mr1071 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004482207 NA 6.88E-06 mr1100 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004482207 NA 2.90E-07 mr1140 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004482207 NA 3.97E-06 mr1203 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004482207 NA 3.11E-07 mr1395 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004482207 NA 8.05E-08 mr1613 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004482207 NA 1.82E-06 mr1618 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004482207 1.28E-08 5.60E-13 mr1913 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004482207 NA 5.92E-07 mr1071_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004482207 1.58E-06 9.72E-10 mr1100_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004482207 NA 1.27E-07 mr1203_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004482207 NA 1.22E-08 mr1613_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004482207 6.18E-06 3.92E-07 mr1795_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004482207 6.88E-06 3.73E-09 mr1913_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251