Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1004482171:

Variant ID: vg1004482171 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 4482171
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, G: 0.00, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:

AATACAACTACATAACATAAGTATGAAAATACTTTGGACCAAACGTCCGACGGGAGACAATTCATCGGATGCTACACCCACCGAGCCCACTTCACTCCCA[A/G]
CGACCATCCATCCCTATCCCCACCTCTCTCACTTCCCTCATCTCTCATCTCTCTATCCAAGCAGTCCGCTGTGATAAACATGATAAATCGTGCGTCGCCG

Reverse complement sequence

CGGCGACGCACGATTTATCATGTTTATCACAGCGGACTGCTTGGATAGAGAGATGAGAGATGAGGGAAGTGAGAGAGGTGGGGATAGGGATGGATGGTCG[T/C]
TGGGAGTGAAGTGGGCTCGGTGGGTGTAGCATCCGATGAATTGTCTCCCGTCGGACGTTTGGTCCAAAGTATTTTCATACTTATGTTATGTAGTTGTATT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	91.30%	8.60%	0.02%	0.00%	NA
All Indica	2759	94.50%	5.40%	0.04%	0.00%	NA
All Japonica	1512	84.00%	16.00%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	88.00%	12.00%	0.00%	0.00%	NA
Indica III	913	92.40%	7.40%	0.11%	0.00%	NA
Indica Intermediate	786	96.70%	3.30%	0.00%	0.00%	NA
Temperate Japonica	767	85.10%	14.90%	0.00%	0.00%	NA
Tropical Japonica	504	87.70%	12.30%	0.00%	0.00%	NA
Japonica Intermediate	241	72.60%	27.40%	0.00%	0.00%	NA
VI/Aromatic	96	86.50%	13.50%	0.00%	0.00%	NA
Intermediate	90	96.70%	3.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1004482171	A -> G	LOC_Os10g08300.1	upstream_gene_variant ; 2105.0bp to feature; MODIFIER	silent_mutation	Average:64.226; most accessible tissue: Zhenshan97 young leaf, score: 88.878	N	N	N	N
vg1004482171	A -> G	LOC_Os10g08280.1	downstream_gene_variant ; 2283.0bp to feature; MODIFIER	silent_mutation	Average:64.226; most accessible tissue: Zhenshan97 young leaf, score: 88.878	N	N	N	N
vg1004482171	A -> G	LOC_Os10g08290.1	downstream_gene_variant ; 766.0bp to feature; MODIFIER	silent_mutation	Average:64.226; most accessible tissue: Zhenshan97 young leaf, score: 88.878	N	N	N	N
vg1004482171	A -> G	LOC_Os10g08290-LOC_Os10g08300	intergenic_region ; MODIFIER	silent_mutation	Average:64.226; most accessible tissue: Zhenshan97 young leaf, score: 88.878	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1004482171	NA	4.67E-13	mr1016	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004482171	NA	5.38E-12	mr1017	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004482171	NA	1.56E-09	mr1023	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004482171	NA	1.51E-12	mr1055	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004482171	NA	5.68E-12	mr1079	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004482171	NA	1.42E-10	mr1132	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004482171	NA	5.23E-11	mr1142	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004482171	NA	9.89E-12	mr1178	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004482171	NA	1.98E-12	mr1390	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004482171	NA	8.56E-08	mr1489	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004482171	NA	3.95E-12	mr1490	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004482171	NA	8.19E-11	mr1491	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004482171	NA	7.63E-06	mr1608	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004482171	5.17E-07	1.47E-08	mr1708	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004482171	NA	4.02E-14	mr1022_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004482171	NA	3.36E-11	mr1023_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004482171	NA	9.14E-15	mr1055_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004482171	NA	5.25E-14	mr1079_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004482171	NA	2.24E-12	mr1132_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004482171	NA	4.23E-14	mr1178_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004482171	NA	2.31E-13	mr1390_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004482171	NA	1.41E-12	mr1490_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004482171	NA	1.97E-06	mr1608_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004482171	5.47E-06	NA	mr1768_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004482171	NA	8.34E-07	mr1792_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251