\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1004481242:

Variant ID: vg1004481242 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 4481242
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.00, others allele: 0.00, population size: 313. )

Flanking Sequence (100 bp) in Reference Genome:


CGCAGCTGCTTCCTCCTCTACACCAGCCATATGTTTGTCTTCACCGACAATACATCACCAATGGTCTTCATCAACACGCTGCCGCCGTATCGTCCACAAG[C/T]
ATGGACACATGCGTGTCCTCTGACAGATTAATCTGCAAGACGCTTCATCGACGACAACATCGATTACGTCCTGTACGACGGCAACGACCGCGTCACCGAT

Reverse complement sequence

ATCGGTGACGCGGTCGTTGCCGTCGTACAGGACGTAATCGATGTTGTCGTCGATGAAGCGTCTTGCAGATTAATCTGTCAGAGGACACGCATGTGTCCAT[G/A]
CTTGTGGACGATACGGCGGCAGCGTGTTGATGAAGACCATTGGTGATGTATTGTCGGTGAAGACAAACATATGGCTGGTGTAGAGGAGGAAGCAGCTGCG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 98.40% 1.10% 0.44% 0.00% NA
All Indica  2759 99.90% 0.00% 0.07% 0.00% NA
All Japonica  1512 95.60% 3.10% 1.26% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.90% 0.00% 0.11% 0.00% NA
Indica Intermediate  786 99.90% 0.00% 0.13% 0.00% NA
Temperate Japonica  767 96.30% 1.30% 2.35% 0.00% NA
Tropical Japonica  504 98.20% 1.80% 0.00% 0.00% NA
Japonica Intermediate  241 88.00% 11.60% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 93.30% 6.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1004481242 C -> T LOC_Os10g08300.1 upstream_gene_variant ; 3034.0bp to feature; MODIFIER silent_mutation Average:66.418; most accessible tissue: Zhenshan97 young leaf, score: 90.815 N N N N
vg1004481242 C -> T LOC_Os10g08280.1 downstream_gene_variant ; 1354.0bp to feature; MODIFIER silent_mutation Average:66.418; most accessible tissue: Zhenshan97 young leaf, score: 90.815 N N N N
vg1004481242 C -> T LOC_Os10g08290.1 intron_variant ; MODIFIER silent_mutation Average:66.418; most accessible tissue: Zhenshan97 young leaf, score: 90.815 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1004481242 NA 1.87E-06 mr1071 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004481242 NA 8.34E-06 mr1100 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004481242 NA 1.00E-07 mr1140 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004481242 NA 1.65E-06 mr1203 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004481242 NA 3.80E-08 mr1395 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004481242 NA 6.19E-09 mr1613 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004481242 NA 9.48E-07 mr1618 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004481242 5.73E-08 5.31E-11 mr1913 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004481242 NA 1.38E-07 mr1071_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004481242 NA 2.98E-06 mr1080_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004481242 5.00E-08 1.88E-10 mr1100_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004481242 NA 1.81E-08 mr1203_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004481242 NA 6.31E-09 mr1613_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004481242 NA 6.75E-06 mr1795_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004481242 NA 1.27E-06 mr1913_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251