\
| Variant ID: vg1004450805 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 4450805 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GGACGAAGCCTACTCCTCGGAAAAGTCACCATCCGACGCATACTCAAACTCTGGGGTTTTGGGGAAAATAGAGCAAGACTGAGTACAACCACCGTACTCA[G/A]
CAAGTCATACCGGAACAGGGGGTATGATGCAGGATATAACCAAAGGATAGCTAAAGCGGTTCATTTGCATAAATTGAGCATTTATAAACAGTAGTTGAAA
TTTCAACTACTGTTTATAAATGCTCAATTTATGCAAATGAACCGCTTTAGCTATCCTTTGGTTATATCCTGCATCATACCCCCTGTTCCGGTATGACTTG[C/T]
TGAGTACGGTGGTTGTACTCAGTCTTGCTCTATTTTCCCCAAAACCCCAGAGTTTGAGTATGCGTCGGATGGTGACTTTTCCGAGGAGTAGGCTTCGTCC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 71.60% | 9.60% | 0.85% | 17.92% | NA |
| All Indica | 2759 | 83.00% | 0.70% | 1.09% | 15.22% | NA |
| All Japonica | 1512 | 62.00% | 26.10% | 0.20% | 11.64% | NA |
| Aus | 269 | 16.00% | 0.00% | 1.49% | 82.53% | NA |
| Indica I | 595 | 65.70% | 0.00% | 1.68% | 32.61% | NA |
| Indica II | 465 | 82.60% | 0.20% | 0.86% | 16.34% | NA |
| Indica III | 913 | 91.50% | 0.80% | 1.31% | 6.46% | NA |
| Indica Intermediate | 786 | 86.50% | 1.40% | 0.51% | 11.58% | NA |
| Temperate Japonica | 767 | 89.20% | 5.50% | 0.00% | 5.35% | NA |
| Tropical Japonica | 504 | 26.80% | 59.50% | 0.40% | 13.29% | NA |
| Japonica Intermediate | 241 | 49.40% | 22.00% | 0.41% | 28.22% | NA |
| VI/Aromatic | 96 | 50.00% | 26.00% | 3.12% | 20.83% | NA |
| Intermediate | 90 | 74.40% | 15.60% | 0.00% | 10.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1004450805 | G -> A | LOC_Os10g08230.1 | downstream_gene_variant ; 3509.0bp to feature; MODIFIER | silent_mutation | Average:18.454; most accessible tissue: Callus, score: 30.618 | N | N | N | N |
| vg1004450805 | G -> A | LOC_Os10g08240.1 | intron_variant ; MODIFIER | silent_mutation | Average:18.454; most accessible tissue: Callus, score: 30.618 | N | N | N | N |
| vg1004450805 | G -> DEL | N | N | silent_mutation | Average:18.454; most accessible tissue: Callus, score: 30.618 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1004450805 | 4.71E-06 | NA | mr1021 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004450805 | NA | 5.73E-07 | mr1248 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004450805 | NA | 6.99E-09 | mr1248 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004450805 | 2.10E-06 | NA | mr1471 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004450805 | NA | 1.25E-08 | mr1471 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004450805 | 1.08E-07 | NA | mr1477 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004450805 | NA | 1.15E-12 | mr1553 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004450805 | NA | 3.77E-10 | mr1642 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004450805 | NA | 1.10E-06 | mr1642 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004450805 | NA | 4.41E-06 | mr1782 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004450805 | NA | 9.53E-07 | mr1797 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004450805 | NA | 9.53E-07 | mr1801 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004450805 | NA | 8.54E-07 | mr1553_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004450805 | NA | 1.16E-06 | mr1632_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004450805 | NA | 4.21E-07 | mr1696_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004450805 | NA | 6.21E-08 | mr1817_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |