Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1004396444:

Variant ID: vg1004396444 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 4396444
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.53, C: 0.47, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


CACGGTCTCGGCCGAAGCTCCTATCTCACCCTTGCCCGTGAGGGGCTTGTTGGAGGTATGGCATGAGGCCCTTCGAACAAACCTACCGAAACCATACGAC[T/C]
AGTGAGGATTCAAGCCCGAGACGTCAAGGTTAGTCAAGGCGAAGCCCCCCCATGGCGAAGACTATGGAACAAGGACGGCGAGAGGCGGGGAATCGCGCGG

Reverse complement sequence

CCGCGCGATTCCCCGCCTCTCGCCGTCCTTGTTCCATAGTCTTCGCCATGGGGGGGCTTCGCCTTGACTAACCTTGACGTCTCGGGCTTGAATCCTCACT[A/G]
GTCGTATGGTTTCGGTAGGTTTGTTCGAAGGGCCTCATGCCATACCTCCAACAAGCCCCTCACGGGCAAGGGTGAGATAGGAGCTTCGGCCGAGACCGTG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 25.70% 25.00% 6.92% 42.32% NA
All Indica  2759 16.30% 23.30% 11.45% 48.93% NA
All Japonica  1512 48.40% 14.70% 0.26% 36.57% NA
Aus  269 0.40% 94.10% 0.00% 5.58% NA
Indica I  595 30.80% 43.50% 2.69% 23.03% NA
Indica II  465 17.80% 23.90% 2.37% 55.91% NA
Indica III  913 2.40% 11.60% 20.59% 65.39% NA
Indica Intermediate  786 20.60% 21.20% 12.85% 45.29% NA
Temperate Japonica  767 73.90% 7.80% 0.00% 18.25% NA
Tropical Japonica  504 15.10% 16.70% 0.20% 68.06% NA
Japonica Intermediate  241 36.90% 32.80% 1.24% 29.05% NA
VI/Aromatic  96 11.50% 38.50% 2.08% 47.92% NA
Intermediate  90 24.40% 30.00% 5.56% 40.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1004396444 T -> C LOC_Os10g08130.1 upstream_gene_variant ; 555.0bp to feature; MODIFIER silent_mutation Average:63.047; most accessible tissue: Zhenshan97 flag leaf, score: 83.526 N N N N
vg1004396444 T -> C LOC_Os10g08140.1 upstream_gene_variant ; 52.0bp to feature; MODIFIER silent_mutation Average:63.047; most accessible tissue: Zhenshan97 flag leaf, score: 83.526 N N N N
vg1004396444 T -> C LOC_Os10g08150.1 upstream_gene_variant ; 1562.0bp to feature; MODIFIER silent_mutation Average:63.047; most accessible tissue: Zhenshan97 flag leaf, score: 83.526 N N N N
vg1004396444 T -> C LOC_Os10g08130-LOC_Os10g08140 intergenic_region ; MODIFIER silent_mutation Average:63.047; most accessible tissue: Zhenshan97 flag leaf, score: 83.526 N N N N
vg1004396444 T -> DEL N N silent_mutation Average:63.047; most accessible tissue: Zhenshan97 flag leaf, score: 83.526 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1004396444 T C -0.01 -0.01 0.0 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1004396444 NA 2.02E-08 mr1153_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004396444 NA 1.05E-15 mr1217_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004396444 NA 1.56E-06 mr1262_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004396444 NA 1.35E-08 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004396444 NA 4.78E-07 mr1407_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004396444 NA 1.42E-07 mr1606_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004396444 NA 1.93E-24 mr1653_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004396444 NA 4.19E-08 mr1681_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004396444 NA 1.58E-07 mr1869_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004396444 NA 4.61E-08 mr1909_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251