Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1004380487:

Variant ID: vg1004380487 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 4380487
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CGTCCATAAAACTCAAATCTTATGTCCCGAAGCAGCATCAACTAGTTGATCGGCTACTGGCATTGGGTATTCATCTTTCGGGGTGGCCTTATTCAAATTT[C/T]
GGAAATCAATGCATACCCTGACCTTGCCCTTTTTCTTGATAACAGGAACTATACTAGAAACCCACTCAGCATATCGGCAAGGACGAATAAAACCAGCATC

Reverse complement sequence

GATGCTGGTTTTATTCGTCCTTGCCGATATGCTGAGTGGGTTTCTAGTATAGTTCCTGTTATCAAGAAAAAGGGCAAGGTCAGGGTATGCATTGATTTCC[G/A]
AAATTTGAATAAGGCCACCCCGAAAGATGAATACCCAATGCCAGTAGCCGATCAACTAGTTGATGCTGCTTCGGGACATAAGATTTGAGTTTTATGGACG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	78.30%	1.80%	1.78%	18.11%	NA
All Indica	2759	79.30%	0.50%	2.32%	17.83%	NA
All Japonica	1512	73.60%	4.70%	1.06%	20.63%	NA
Aus	269	96.70%	0.00%	0.00%	3.35%	NA
Indica I	595	91.90%	0.50%	1.18%	6.39%	NA
Indica II	465	76.80%	0.00%	3.66%	19.57%	NA
Indica III	913	74.50%	0.40%	2.08%	23.00%	NA
Indica Intermediate	786	77.00%	0.90%	2.67%	19.47%	NA
Temperate Japonica	767	84.90%	7.40%	0.26%	7.43%	NA
Tropical Japonica	504	55.20%	0.00%	2.18%	42.66%	NA
Japonica Intermediate	241	76.30%	5.80%	1.24%	16.60%	NA
VI/Aromatic	96	70.80%	0.00%	1.04%	28.12%	NA
Intermediate	90	76.70%	2.20%	3.33%	17.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1004380487	C -> T	LOC_Os10g08100.1	upstream_gene_variant ; 1943.0bp to feature; MODIFIER	silent_mutation	Average:36.082; most accessible tissue: Zhenshan97 flag leaf, score: 59.429	N	N	N	N
vg1004380487	C -> T	LOC_Os10g08080.1	downstream_gene_variant ; 3165.0bp to feature; MODIFIER	silent_mutation	Average:36.082; most accessible tissue: Zhenshan97 flag leaf, score: 59.429	N	N	N	N
vg1004380487	C -> T	LOC_Os10g08090.1	intron_variant ; MODIFIER	silent_mutation	Average:36.082; most accessible tissue: Zhenshan97 flag leaf, score: 59.429	N	N	N	N
vg1004380487	C -> DEL	N	N	silent_mutation	Average:36.082; most accessible tissue: Zhenshan97 flag leaf, score: 59.429	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1004380487	NA	8.80E-09	mr1913	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004380487	NA	9.96E-09	mr1071_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004380487	NA	2.38E-07	mr1080_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004380487	7.02E-07	9.51E-12	mr1100_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004380487	NA	3.83E-08	mr1203_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004380487	NA	6.13E-08	mr1402_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004380487	NA	3.06E-10	mr1613_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004380487	NA	7.22E-08	mr1619_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004380487	5.90E-07	4.14E-09	mr1795_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004380487	NA	4.24E-12	mr1913_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004380487	NA	1.89E-07	mr1962_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251