\
| Variant ID: vg1004374773 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 4374773 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.01, others allele: 0.00, population size: 113. )
TTACTGGATTAGATGTAACTTCATCGGCTAACCCTATGAGTATGAACGCCAAGAATCAATTTGACTTCAAGACCAAAAGCATAGGTGGCTGGTCTGGCTA[T/C]
GTGGCGGCATATATGGGCCAAGGGTCTGTTACCCCTCGAGAGCATGTAGCTTTCTTGGTCATGTGGCTGGAAAAGTTCCTCTTTTGTGGATCCAGTTGTG
CACAACTGGATCCACAAAAGAGGAACTTTTCCAGCCACATGACCAAGAAAGCTACATGCTCTCGAGGGGTAACAGACCCTTGGCCCATATATGCCGCCAC[A/G]
TAGCCAGACCAGCCACCTATGCTTTTGGTCTTGAAGTCAAATTGATTCTTGGCGTTCATACTCATAGGGTTAGCCGATGAAGTTACATCTAATCCAGTAA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 56.70% | 14.70% | 1.06% | 27.47% | NA |
| All Indica | 2759 | 46.50% | 24.30% | 1.23% | 27.98% | NA |
| All Japonica | 1512 | 68.60% | 0.90% | 0.46% | 30.03% | NA |
| Aus | 269 | 94.80% | 0.40% | 0.00% | 4.83% | NA |
| Indica I | 595 | 79.00% | 6.10% | 0.84% | 14.12% | NA |
| Indica II | 465 | 46.90% | 7.50% | 0.86% | 44.73% | NA |
| Indica III | 913 | 24.60% | 47.30% | 1.42% | 26.62% | NA |
| Indica Intermediate | 786 | 47.10% | 21.20% | 1.53% | 30.15% | NA |
| Temperate Japonica | 767 | 89.30% | 0.10% | 0.65% | 9.91% | NA |
| Tropical Japonica | 504 | 34.70% | 0.60% | 0.20% | 64.48% | NA |
| Japonica Intermediate | 241 | 73.40% | 4.10% | 0.41% | 21.99% | NA |
| VI/Aromatic | 96 | 52.10% | 2.10% | 7.29% | 38.54% | NA |
| Intermediate | 90 | 62.20% | 11.10% | 2.22% | 24.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1004374773 | T -> C | LOC_Os10g08080.1 | synonymous_variant ; p.Tyr166Tyr; LOW | synonymous_codon | Average:39.772; most accessible tissue: Zhenshan97 flag leaf, score: 67.31 | N | N | N | N |
| vg1004374773 | T -> DEL | LOC_Os10g08080.1 | N | frameshift_variant | Average:39.772; most accessible tissue: Zhenshan97 flag leaf, score: 67.31 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1004374773 | NA | 4.54E-07 | mr1066 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004374773 | NA | 5.61E-06 | mr1106 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004374773 | NA | 9.02E-06 | mr1407 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004374773 | 8.66E-08 | 2.03E-06 | mr1568 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004374773 | 4.49E-07 | 4.49E-07 | mr1568 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004374773 | 2.93E-06 | NA | mr1631 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004374773 | NA | 5.44E-07 | mr1631 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004374773 | NA | 8.89E-06 | mr1908_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |