\
| Variant ID: vg1004372914 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 4372914 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, A: 0.03, others allele: 0.00, population size: 109. )
TAAAACAAGTAAAATATATCAAACAAGAGCCTAATATACTTAAATGCAGTAAGATCTTGACATAAAGGGCAGATTTAATGTATCATTGAAGCATATAGAG[C/A]
AAATATAATTAAATCAGGTAAGATCGGCTGAAACTCCGATACTATTCTAATCGGCAACCAGGAGGCAGGCTAGAGATTGATATTCTAAGCACGACTTAAT
ATTAAGTCGTGCTTAGAATATCAATCTCTAGCCTGCCTCCTGGTTGCCGATTAGAATAGTATCGGAGTTTCAGCCGATCTTACCTGATTTAATTATATTT[G/T]
CTCTATATGCTTCAATGATACATTAAATCTGCCCTTTATGTCAAGATCTTACTGCATTTAAGTATATTAGGCTCTTGTTTGATATATTTTACTTGTTTTA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 54.20% | 16.00% | 3.68% | 26.11% | NA |
| All Indica | 2759 | 59.60% | 16.40% | 2.79% | 21.28% | NA |
| All Japonica | 1512 | 54.60% | 1.20% | 5.49% | 38.69% | NA |
| Aus | 269 | 5.60% | 92.90% | 0.74% | 0.74% | NA |
| Indica I | 595 | 45.70% | 42.40% | 3.70% | 8.24% | NA |
| Indica II | 465 | 69.50% | 10.50% | 2.37% | 17.63% | NA |
| Indica III | 913 | 60.00% | 3.20% | 2.63% | 34.17% | NA |
| Indica Intermediate | 786 | 63.60% | 15.50% | 2.54% | 18.32% | NA |
| Temperate Japonica | 767 | 77.70% | 0.40% | 7.04% | 14.86% | NA |
| Tropical Japonica | 504 | 23.60% | 2.00% | 3.77% | 70.63% | NA |
| Japonica Intermediate | 241 | 46.10% | 2.10% | 4.15% | 47.72% | NA |
| VI/Aromatic | 96 | 30.20% | 19.80% | 8.33% | 41.67% | NA |
| Intermediate | 90 | 54.40% | 18.90% | 4.44% | 22.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1004372914 | C -> A | LOC_Os10g08080.1 | upstream_gene_variant ; 1194.0bp to feature; MODIFIER | silent_mutation | Average:13.398; most accessible tissue: Zhenshan97 flag leaf, score: 30.355 | N | N | N | N |
| vg1004372914 | C -> A | LOC_Os10g08060.1 | downstream_gene_variant ; 2056.0bp to feature; MODIFIER | silent_mutation | Average:13.398; most accessible tissue: Zhenshan97 flag leaf, score: 30.355 | N | N | N | N |
| vg1004372914 | C -> A | LOC_Os10g08070.1 | downstream_gene_variant ; 709.0bp to feature; MODIFIER | silent_mutation | Average:13.398; most accessible tissue: Zhenshan97 flag leaf, score: 30.355 | N | N | N | N |
| vg1004372914 | C -> A | LOC_Os10g08070-LOC_Os10g08080 | intergenic_region ; MODIFIER | silent_mutation | Average:13.398; most accessible tissue: Zhenshan97 flag leaf, score: 30.355 | N | N | N | N |
| vg1004372914 | C -> DEL | N | N | silent_mutation | Average:13.398; most accessible tissue: Zhenshan97 flag leaf, score: 30.355 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1004372914 | 4.14E-06 | 3.52E-07 | mr1087 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004372914 | 4.42E-06 | 1.23E-07 | mr1090 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004372914 | 2.73E-06 | 2.77E-07 | mr1094 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004372914 | NA | 2.16E-06 | mr1096 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |