\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1004372914:

Variant ID: vg1004372914 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 4372914
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, A: 0.03, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


TAAAACAAGTAAAATATATCAAACAAGAGCCTAATATACTTAAATGCAGTAAGATCTTGACATAAAGGGCAGATTTAATGTATCATTGAAGCATATAGAG[C/A]
AAATATAATTAAATCAGGTAAGATCGGCTGAAACTCCGATACTATTCTAATCGGCAACCAGGAGGCAGGCTAGAGATTGATATTCTAAGCACGACTTAAT

Reverse complement sequence

ATTAAGTCGTGCTTAGAATATCAATCTCTAGCCTGCCTCCTGGTTGCCGATTAGAATAGTATCGGAGTTTCAGCCGATCTTACCTGATTTAATTATATTT[G/T]
CTCTATATGCTTCAATGATACATTAAATCTGCCCTTTATGTCAAGATCTTACTGCATTTAAGTATATTAGGCTCTTGTTTGATATATTTTACTTGTTTTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.20% 16.00% 3.68% 26.11% NA
All Indica  2759 59.60% 16.40% 2.79% 21.28% NA
All Japonica  1512 54.60% 1.20% 5.49% 38.69% NA
Aus  269 5.60% 92.90% 0.74% 0.74% NA
Indica I  595 45.70% 42.40% 3.70% 8.24% NA
Indica II  465 69.50% 10.50% 2.37% 17.63% NA
Indica III  913 60.00% 3.20% 2.63% 34.17% NA
Indica Intermediate  786 63.60% 15.50% 2.54% 18.32% NA
Temperate Japonica  767 77.70% 0.40% 7.04% 14.86% NA
Tropical Japonica  504 23.60% 2.00% 3.77% 70.63% NA
Japonica Intermediate  241 46.10% 2.10% 4.15% 47.72% NA
VI/Aromatic  96 30.20% 19.80% 8.33% 41.67% NA
Intermediate  90 54.40% 18.90% 4.44% 22.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1004372914 C -> A LOC_Os10g08080.1 upstream_gene_variant ; 1194.0bp to feature; MODIFIER silent_mutation Average:13.398; most accessible tissue: Zhenshan97 flag leaf, score: 30.355 N N N N
vg1004372914 C -> A LOC_Os10g08060.1 downstream_gene_variant ; 2056.0bp to feature; MODIFIER silent_mutation Average:13.398; most accessible tissue: Zhenshan97 flag leaf, score: 30.355 N N N N
vg1004372914 C -> A LOC_Os10g08070.1 downstream_gene_variant ; 709.0bp to feature; MODIFIER silent_mutation Average:13.398; most accessible tissue: Zhenshan97 flag leaf, score: 30.355 N N N N
vg1004372914 C -> A LOC_Os10g08070-LOC_Os10g08080 intergenic_region ; MODIFIER silent_mutation Average:13.398; most accessible tissue: Zhenshan97 flag leaf, score: 30.355 N N N N
vg1004372914 C -> DEL N N silent_mutation Average:13.398; most accessible tissue: Zhenshan97 flag leaf, score: 30.355 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1004372914 4.14E-06 3.52E-07 mr1087 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004372914 4.42E-06 1.23E-07 mr1090 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004372914 2.73E-06 2.77E-07 mr1094 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004372914 NA 2.16E-06 mr1096 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251